Mutagenetix > Incidental Mutation

Incidental Mutation 'R1768:Has1'

194637

Institutional Source

Beutler Lab

Gene Symbol

Has1

Ensembl Gene

ENSMUSG00000003665

Gene Name

hyaluronan synthase 1

Synonyms

MMRRC Submission

039799-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1768 (G1)

Quality Score

209

Status

Validated

Chromosome

Chromosomal Location

17843323-17855205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17850300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 120 (T120A)

Ref Sequence

ENSEMBL: ENSMUSP00000003762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003762]

AlphaFold

Q61647

Predicted Effect

probably benign
Transcript: ENSMUST00000003762
AA Change: T120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003762
Gene: ENSMUSG00000003665
AA Change: T120A

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
transmembrane domain	53	75	N/A	INTRINSIC
low complexity region	78	86	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	179	387	1.1e-21	PFAM
Pfam:Glyco_transf_21	205	386	1.2e-8	PFAM
Pfam:Chitin_synth_2	222	394	1.6e-16	PFAM
Pfam:Glyco_trans_2_3	237	453	5.6e-16	PFAM
transmembrane domain	464	486	N/A	INTRINSIC
transmembrane domain	501	523	N/A	INTRINSIC
transmembrane domain	544	566	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232410

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

91% (107/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and appear grossly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	G	C	18: 6,623,470	R60P	possibly damaging	Het
Aox2	T	A	1: 58,354,195	C1199S	probably benign	Het
Arhgap18	G	A	10: 26,887,861	M482I	probably damaging	Het
Arhgap18	G	T	10: 26,887,862	A483S	probably damaging	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
BC051019	T	C	7: 109,723,174	T38A	probably benign	Het
Bcam	T	C	7: 19,765,618	N192S	probably null	Het
Bend5	A	T	4: 111,454,241	K351*	probably null	Het
Bicdl2	T	A	17: 23,665,949	M208K	probably damaging	Het
Ccdc155	T	A	7: 45,188,803		probably null	Het
Ccp110	A	T	7: 118,726,024		probably null	Het
Cdc6	A	T	11: 98,912,217	T328S	probably damaging	Het
Cdk5rap2	G	T	4: 70,307,233	N558K	probably benign	Het
Cdkn1c	C	T	7: 143,459,121	R146K	probably benign	Het
Ceacam18	G	A	7: 43,648,494	C371Y	probably benign	Het
Cep95	T	A	11: 106,806,351	C233*	probably null	Het
Chrnd	A	G	1: 87,194,928	I144V	probably benign	Het
Col6a4	T	A	9: 106,080,100	Q175L	probably benign	Het
Cym	A	T	3: 107,213,500	V263E	probably damaging	Het
Cyp2a4	G	T	7: 26,312,772	V327F	possibly damaging	Het
Dhx29	T	A	13: 112,948,240	M664K	probably damaging	Het
Dlec1	T	G	9: 119,146,007		probably null	Het
Dna2	T	C	10: 62,957,084	Y293H	probably benign	Het
Dnase1l3	T	A	14: 7,974,104	N196Y	probably damaging	Het
Eea1	T	A	10: 95,996,960	D222E	probably damaging	Het
Efcab14	A	T	4: 115,752,919		probably null	Het
Entpd5	C	T	12: 84,386,211	R189H	probably benign	Het
Exoc4	A	T	6: 33,758,050	K534M	probably damaging	Het
Extl1	T	A	4: 134,371,138	Y194F	probably benign	Het
Eya1	A	G	1: 14,253,075	L161S	possibly damaging	Het
Fam163b	T	C	2: 27,112,862	E41G	possibly damaging	Het
Fam180a	A	C	6: 35,315,352	S40A	probably benign	Het
Fbxl4	T	C	4: 22,385,950	S186P	probably benign	Het
Fbxw19	A	T	9: 109,494,772	L45*	probably null	Het
Fgf14	G	T	14: 124,676,512	T69N	probably benign	Het
Flt1	A	G	5: 147,672,709	Y432H	probably damaging	Het
Frmd4b	A	T	6: 97,306,764	L374Q	possibly damaging	Het
G6pc2	T	A	2: 69,222,977	V125D	probably damaging	Het
Gna15	A	T	10: 81,512,120	L164Q	probably damaging	Het
Gnaz	C	A	10: 74,991,870	D151E	possibly damaging	Het
Hectd4	T	A	5: 121,358,303	D3919E	possibly damaging	Het
Hs3st5	A	G	10: 36,833,169	I233M	probably benign	Het
Ilf3	T	C	9: 21,403,142		probably benign	Het
Inpp5b	T	A	4: 124,793,276	L765*	probably null	Het
Insr	A	T	8: 3,159,561	I1174N	probably damaging	Het
Kcnq3	A	G	15: 66,005,906	L445P	probably damaging	Het
Kctd20	A	T	17: 28,962,850	N159Y	probably damaging	Het
Kctd20	A	T	17: 28,966,781	D366V	probably damaging	Het
Klk15	T	C	7: 43,938,333		probably benign	Het
Lama4	T	G	10: 39,103,501	N1658K	possibly damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mas1	T	C	17: 12,841,699	Y279C	probably damaging	Het
Mast2	G	T	4: 116,306,959	D1747E	probably damaging	Het
Mest	G	A	6: 30,745,139	M235I	probably benign	Het
Mfsd6	A	G	1: 52,660,805		probably null	Het
Mllt10	T	A	2: 18,162,846	S449R	probably damaging	Het
Mon2	T	A	10: 123,013,763	T1211S	probably benign	Het
Mrnip	G	A	11: 50,176,861	C27Y	probably damaging	Het
Myh15	A	T	16: 49,163,135	T1538S	probably benign	Het
Nfatc2ip	A	G	7: 126,390,462	V250A	probably benign	Het
Npy1r	A	G	8: 66,704,525	D199G	possibly damaging	Het
Numbl	A	G	7: 27,280,954	T454A	probably benign	Het
Nutm2	T	G	13: 50,473,116	F436V	probably damaging	Het
Olfr1112	T	A	2: 87,191,698	S4T	probably benign	Het
Olfr330	A	G	11: 58,529,776	L70P	probably damaging	Het
Olfr458	A	G	6: 42,460,677	L114S	probably damaging	Het
Olfr556	A	G	7: 102,670,301	Y127C	probably damaging	Het
Olfr631	C	T	7: 103,929,725	R301*	probably null	Het
Olfr64	A	G	7: 103,893,277	S153P	probably benign	Het
Olfr676	A	G	7: 105,035,950	S251G	probably benign	Het
Olfr707	A	T	7: 106,891,977		probably null	Het
Olfr707	G	T	7: 106,891,978	L44M	probably damaging	Het
Olfr876	T	A	9: 37,804,303	Y131N	probably damaging	Het
Opa1	T	C	16: 29,620,810	S773P	probably benign	Het
Pde8a	G	C	7: 81,300,723		probably null	Het
Pgam1	T	C	19: 41,917,705	F232S	probably damaging	Het
Pgk1	T	A	X: 106,200,308	V303E	possibly damaging	Het
Pirb	A	T	7: 3,717,190	C395S	probably damaging	Het
Plxnc1	C	T	10: 94,844,322	V824I	probably benign	Het
Ppp6r1	A	G	7: 4,633,692		probably null	Het
Rapgef4	C	A	2: 72,225,787		probably benign	Het
Rars	T	A	11: 35,809,638	T539S	probably damaging	Het
Rbm44	G	T	1: 91,153,957		probably null	Het
RP23-114B10.6	T	C	8: 69,373,558	I119M	unknown	Het
Samd4b	A	G	7: 28,413,892	I216T	probably benign	Het
Serpine2	A	C	1: 79,816,815	F134V	probably damaging	Het
Shmt1	A	G	11: 60,792,964	Y341H	probably damaging	Het
Slc23a2	C	A	2: 132,075,641	V226F	probably benign	Het
Slc23a4	A	G	6: 34,956,961	I69T	probably damaging	Het
Slc37a1	C	A	17: 31,333,678	T319K	possibly damaging	Het
Slc6a4	A	T	11: 77,013,252	T178S	probably damaging	Het
Smarca4	G	A	9: 21,701,183	A1588T	possibly damaging	Het
Spag17	A	T	3: 100,027,352	Y650F	possibly damaging	Het
Stab2	C	T	10: 87,003,008	G65S	probably damaging	Het
Stambpl1	C	G	19: 34,226,721	N70K	probably damaging	Het
Stip1	C	A	19: 7,021,797	C471F	probably damaging	Het
Taf1	T	C	X: 101,540,894	S223P	probably benign	Het
Tchh	C	A	3: 93,443,575	N107K	possibly damaging	Het
Tenm3	A	C	8: 48,232,104	H2432Q	probably damaging	Het
Tmem243	A	G	5: 9,118,548	N110S	probably damaging	Het
Toe1	A	T	4: 116,804,879	I306F	probably benign	Het
Trank1	G	A	9: 111,392,927	V2911M	probably damaging	Het
Trpm4	A	G	7: 45,308,612	I811T	probably damaging	Het
Tspear	T	A	10: 77,875,116		probably null	Het
Ttc28	A	T	5: 111,277,168	I1589F	possibly damaging	Het
Tubgcp3	A	G	8: 12,649,686		probably benign	Het
U2af2	C	A	7: 5,067,545	R78S	probably benign	Het
Wdr17	A	T	8: 54,673,654	D388E	possibly damaging	Het
Wdr3	A	T	3: 100,153,870	S261T	probably benign	Het
Zfp667	A	G	7: 6,305,067	N245D	possibly damaging	Het
Zfp692	A	G	11: 58,310,176		probably benign	Het
Zfp729a	T	C	13: 67,619,251	H953R	probably benign	Het

Other mutations in Has1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01563:Has1	APN	17	17843662	unclassified	probably benign
IGL02551:Has1	APN	17	17848298	missense	probably damaging	1.00
R0149:Has1	UTSW	17	17850171	missense	probably damaging	1.00
R0496:Has1	UTSW	17	17843746	missense	probably benign
R0637:Has1	UTSW	17	17843863	missense	possibly damaging	0.67
R1051:Has1	UTSW	17	17848279	missense	probably damaging	1.00
R1647:Has1	UTSW	17	17849985	missense	probably damaging	1.00
R1648:Has1	UTSW	17	17849985	missense	probably damaging	1.00
R2016:Has1	UTSW	17	17848270	missense	probably damaging	1.00
R3810:Has1	UTSW	17	17847560	missense	probably damaging	0.98
R4235:Has1	UTSW	17	17850036	missense	possibly damaging	0.62
R4467:Has1	UTSW	17	17843995	missense	probably benign	0.05
R5475:Has1	UTSW	17	17848321	missense	possibly damaging	0.57
R5682:Has1	UTSW	17	17844163	missense	possibly damaging	0.58
R6418:Has1	UTSW	17	17849945	missense	probably damaging	1.00
R6841:Has1	UTSW	17	17843860	missense	probably benign	0.06
R7076:Has1	UTSW	17	17843806	missense	probably damaging	1.00
R7767:Has1	UTSW	17	17850530	missense	probably damaging	1.00
R8878:Has1	UTSW	17	17850059	missense	possibly damaging	0.57
R9002:Has1	UTSW	17	17843650	missense	unknown
R9502:Has1	UTSW	17	17843709	missense	probably damaging	1.00
X0028:Has1	UTSW	17	17850453	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACATGACCTCACGTTTGCCGC -3'
(R):5'- ATCGCTATGGACTCCTGGCCTTTG -3'

Sequencing Primer
(F):5'- GTAGGCACCTTCACCGACAG -3'
(R):5'- CTATGGGGCATTCCTCAGC -3'

Posted On

2014-05-23