Incidental Mutation 'R1769:Bmpr2'
ID194650
Institutional Source Beutler Lab
Gene Symbol Bmpr2
Ensembl Gene ENSMUSG00000067336
Gene Namebone morphogenetic protein receptor, type II (serine/threonine kinase)
Synonyms2610024H22Rik, BMPRII, BMPR-II, BMP-2
MMRRC Submission 039800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59763400-59879014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59868361 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 871 (L871Q)
Ref Sequence ENSEMBL: ENSMUSP00000084701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087435]
Predicted Effect probably damaging
Transcript: ENSMUST00000087435
AA Change: L871Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084701
Gene: ENSMUSG00000067336
AA Change: L871Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 33 131 6.9e-17 PFAM
low complexity region 132 142 N/A INTRINSIC
transmembrane domain 152 174 N/A INTRINSIC
Pfam:Pkinase 203 501 6.6e-33 PFAM
Pfam:Pkinase_Tyr 203 501 1.3e-29 PFAM
low complexity region 545 558 N/A INTRINSIC
low complexity region 603 628 N/A INTRINSIC
low complexity region 694 710 N/A INTRINSIC
low complexity region 901 908 N/A INTRINSIC
Meta Mutation Damage Score 0.2538 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type II receptor that binds extracellular BMPs and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important during embryonic development. Mutations in this gene can cause pulmonary hypertension. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous null mutants arrest at the egg cylinder stage and die before embryonic day 9.5 with failure to form organized structure and lacking mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Bmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Bmpr2 APN 1 59815315 missense possibly damaging 0.88
IGL01366:Bmpr2 APN 1 59813677 missense probably damaging 1.00
IGL02281:Bmpr2 APN 1 59868344 missense probably damaging 1.00
IGL02531:Bmpr2 APN 1 59845714 splice site probably null
IGL03114:Bmpr2 APN 1 59867444 missense probably damaging 1.00
R0114:Bmpr2 UTSW 1 59815340 missense probably damaging 1.00
R0145:Bmpr2 UTSW 1 59867580 frame shift probably null
R0423:Bmpr2 UTSW 1 59868510 missense probably benign
R0480:Bmpr2 UTSW 1 59845659 missense probably damaging 1.00
R0556:Bmpr2 UTSW 1 59815328 missense probably damaging 1.00
R0597:Bmpr2 UTSW 1 59841425 splice site probably benign
R1167:Bmpr2 UTSW 1 59859304 missense probably damaging 1.00
R1537:Bmpr2 UTSW 1 59868126 missense probably benign 0.31
R1946:Bmpr2 UTSW 1 59868397 missense possibly damaging 0.83
R1972:Bmpr2 UTSW 1 59813603 missense possibly damaging 0.55
R4524:Bmpr2 UTSW 1 59867412 missense probably benign 0.00
R4558:Bmpr2 UTSW 1 59845692 missense probably damaging 0.99
R4667:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4668:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4669:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4868:Bmpr2 UTSW 1 59870456 missense probably benign 0.03
R4922:Bmpr2 UTSW 1 59867424 missense probably benign
R5015:Bmpr2 UTSW 1 59851224 missense probably damaging 1.00
R5421:Bmpr2 UTSW 1 59870418 missense possibly damaging 0.96
R5808:Bmpr2 UTSW 1 59867401 missense probably benign 0.09
R6057:Bmpr2 UTSW 1 59842818 missense probably benign 0.00
R6228:Bmpr2 UTSW 1 59867436 missense probably benign 0.11
R6449:Bmpr2 UTSW 1 59867437 missense probably damaging 0.99
R6475:Bmpr2 UTSW 1 59868344 missense probably damaging 1.00
R6754:Bmpr2 UTSW 1 59870280 missense probably damaging 1.00
R7080:Bmpr2 UTSW 1 59867683 missense probably benign 0.00
R7410:Bmpr2 UTSW 1 59868493 missense probably benign
R7425:Bmpr2 UTSW 1 59867351 missense probably benign 0.12
R8027:Bmpr2 UTSW 1 59867803 missense probably damaging 1.00
R8032:Bmpr2 UTSW 1 59867343 missense probably benign 0.03
R8117:Bmpr2 UTSW 1 59847093 missense probably damaging 0.99
R8142:Bmpr2 UTSW 1 59870306 missense probably damaging 1.00
R8166:Bmpr2 UTSW 1 59867581 missense probably damaging 0.98
R8376:Bmpr2 UTSW 1 59867356 missense probably damaging 0.99
Z1176:Bmpr2 UTSW 1 59847167 missense not run
Z1177:Bmpr2 UTSW 1 59847167 missense not run
Predicted Primers PCR Primer
(F):5'- GTTAATTCCCATGCTGCCACAACC -3'
(R):5'- CTGTCCCAAAGGGTACTGCATAACC -3'

Sequencing Primer
(F):5'- TGCTGCCACAACCCAGTATG -3'
(R):5'- GTATACTGCTGCCATCCAGG -3'
Posted On2014-05-23