Incidental Mutation 'R1769:Cdh7'
ID194653
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Namecadherin 7, type 2
SynonymsCDH7L1
MMRRC Submission 039800-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location109982431-110140157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110052876 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 178 (T178I)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
Predicted Effect probably damaging
Transcript: ENSMUST00000027542
AA Change: T178I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: T178I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112701
AA Change: T178I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: T178I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000172005
AA Change: T178I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: T178I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0549:Cdh7 UTSW 1 110108944 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1033:Cdh7 UTSW 1 110085053 missense probably damaging 0.96
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1940:Cdh7 UTSW 1 110049024 missense probably benign 0.09
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2137:Cdh7 UTSW 1 110100106 missense probably damaging 0.97
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R5867:Cdh7 UTSW 1 110048851 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
R7511:Cdh7 UTSW 1 109997853 intron probably benign
R7532:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R7879:Cdh7 UTSW 1 110048947 missense probably benign 0.01
R8022:Cdh7 UTSW 1 110061108 missense probably benign 0.02
R8207:Cdh7 UTSW 1 109994346 missense probably damaging 1.00
R8224:Cdh7 UTSW 1 109994203 missense probably benign
R8239:Cdh7 UTSW 1 110100102 missense probably benign 0.11
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Z1176:Cdh7 UTSW 1 110108736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCTGAGCATGATGAAAAGAGACC -3'
(R):5'- GCTCATAGCAAAACCAAATGCTTTCACT -3'

Sequencing Primer
(F):5'- GGCTCTGAGCTGAATGGAATC -3'
(R):5'- TCAGCTAGATAATCCTTCAGGTG -3'
Posted On2014-05-23