Incidental Mutation 'R1769:Ifih1'
ID194657
Institutional Source Beutler Lab
Gene Symbol Ifih1
Ensembl Gene ENSMUSG00000026896
Gene Nameinterferon induced with helicase C domain 1
SynonymsMDA5, Helicard, 9130009C22Rik, MDA-5
MMRRC Submission 039800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62595798-62646255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62606394 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 562 (A562T)
Ref Sequence ENSEMBL: ENSMUSP00000108078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028259] [ENSMUST00000112459]
Predicted Effect probably damaging
Transcript: ENSMUST00000028259
AA Change: A611T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028259
Gene: ENSMUSG00000026896
AA Change: A611T

DomainStartEndE-ValueType
Pfam:CARD_2 7 99 3e-22 PFAM
Pfam:CARD_2 110 200 6.8e-22 PFAM
Pfam:CARD 115 200 2.6e-15 PFAM
low complexity region 248 261 N/A INTRINSIC
DEXDc 305 520 1.08e-26 SMART
Blast:DEXDc 590 712 1e-45 BLAST
HELICc 742 826 1.27e-14 SMART
Pfam:RIG-I_C-RD 903 1018 4.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112459
AA Change: A562T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108078
Gene: ENSMUSG00000026896
AA Change: A562T

DomainStartEndE-ValueType
SCOP:d3ygsp_ 6 88 1e-3 SMART
Pfam:CARD 115 200 3.9e-15 PFAM
DEXDc 256 471 1.08e-26 SMART
Blast:DEXDc 541 663 1e-45 BLAST
HELICc 693 777 1.27e-14 SMART
Pfam:RIG-I_C-RD 852 973 1.5e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176431
Meta Mutation Damage Score 0.3448 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele have increased virus-associated morbidity and mortality, and decreased cytokine response to several viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Ifih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ifih1 APN 2 62645870 missense probably damaging 1.00
IGL00832:Ifih1 APN 2 62645470 splice site probably benign
IGL00906:Ifih1 APN 2 62645824 missense probably benign
IGL01664:Ifih1 APN 2 62611700 splice site probably benign
IGL01820:Ifih1 APN 2 62617313 missense probably damaging 1.00
IGL02016:Ifih1 APN 2 62606984 missense probably benign 0.01
IGL02298:Ifih1 APN 2 62610439 critical splice donor site probably null
IGL02311:Ifih1 APN 2 62610503 missense probably damaging 1.00
IGL02635:Ifih1 APN 2 62611829 missense probably damaging 1.00
Washington UTSW 2 62598799 missense possibly damaging 0.88
R0514:Ifih1 UTSW 2 62623391 critical splice donor site probably null
R1329:Ifih1 UTSW 2 62617487 splice site probably null
R1484:Ifih1 UTSW 2 62610558 missense probably benign 0.00
R2104:Ifih1 UTSW 2 62610545 nonsense probably null
R2125:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2126:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2406:Ifih1 UTSW 2 62607103 splice site probably benign
R3919:Ifih1 UTSW 2 62623501 splice site probably benign
R4033:Ifih1 UTSW 2 62635190 missense probably benign
R4060:Ifih1 UTSW 2 62598799 missense possibly damaging 0.88
R4435:Ifih1 UTSW 2 62645890 missense probably damaging 1.00
R4538:Ifih1 UTSW 2 62617412 missense probably damaging 1.00
R4663:Ifih1 UTSW 2 62609219 missense probably benign 0.00
R4703:Ifih1 UTSW 2 62598876 missense probably benign 0.05
R4897:Ifih1 UTSW 2 62635014 intron probably benign
R5274:Ifih1 UTSW 2 62611718 missense probably benign 0.00
R5949:Ifih1 UTSW 2 62610560 missense probably benign 0.05
R6140:Ifih1 UTSW 2 62601460 missense possibly damaging 0.77
R6223:Ifih1 UTSW 2 62598259 missense probably benign
R6332:Ifih1 UTSW 2 62639483 missense possibly damaging 0.64
R6650:Ifih1 UTSW 2 62606447 missense possibly damaging 0.69
R6813:Ifih1 UTSW 2 62645693 missense possibly damaging 0.90
R6977:Ifih1 UTSW 2 62606186 missense probably damaging 1.00
R7054:Ifih1 UTSW 2 62610515 missense probably benign 0.30
R7167:Ifih1 UTSW 2 62598896 missense probably benign
R7269:Ifih1 UTSW 2 62645633 missense probably benign 0.00
R7397:Ifih1 UTSW 2 62623488 missense possibly damaging 0.85
R7885:Ifih1 UTSW 2 62601469 missense possibly damaging 0.96
Z1176:Ifih1 UTSW 2 62617469 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTTAAGTTGGTCATTGCAACTG -3'
(R):5'- AAGTCCACGTTCCTGCTCACAC -3'

Sequencing Primer
(F):5'- ATTGCAACTGCTGGCCTC -3'
(R):5'- GATGGAGTTGAAAACCATCCTC -3'
Posted On2014-05-23