Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Itga4'

194659

Institutional Source

Beutler Lab

Gene Symbol

Itga4

Ensembl Gene

ENSMUSG00000027009

Gene Name

integrin alpha 4

Synonyms

VLA-4 receptor, alpha 4 subunit

MMRRC Submission

039800-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1769 (G1)

Quality Score

138

Status

Validated

Chromosome

Chromosomal Location

79255426-79333123 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 79315706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099972]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000099972

SMART Domains

Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Int_alpha	48	108	5.14e-7	SMART
Int_alpha	191	241	3.45e1	SMART
Int_alpha	247	300	1.89e-5	SMART
Int_alpha	302	358	2.25e-12	SMART
Int_alpha	364	419	1.45e-15	SMART
Int_alpha	426	483	4.52e-3	SMART
SCOP:d1m1xa2	627	770	1e-35	SMART
Blast:Int_alpha	639	676	9e-16	BLAST
SCOP:d1m1xa3	773	948	7e-42	SMART
transmembrane domain	978	1000	N/A	INTRINSIC
PDB:4HKC\|B	1003	1032	1e-13	PDB

Meta Mutation Damage Score

0.9469

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Itga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Itga4	APN	2	79292050	missense	probably benign	0.01
IGL01317:Itga4	APN	2	79322661	nonsense	probably null
IGL01545:Itga4	APN	2	79315970	splice site	probably benign
IGL01570:Itga4	APN	2	79322634	critical splice acceptor site	probably null
IGL01575:Itga4	APN	2	79288255	missense	probably damaging	1.00
IGL01837:Itga4	APN	2	79315005	missense	probably damaging	1.00
IGL01974:Itga4	APN	2	79273127	splice site	probably benign
IGL02087:Itga4	APN	2	79292069	missense	probably damaging	0.99
IGL02245:Itga4	APN	2	79320559	missense	probably benign	0.01
IGL02492:Itga4	APN	2	79255657	utr 5 prime	probably benign
IGL02809:Itga4	APN	2	79280577	missense	probably damaging	1.00
IGL02998:Itga4	APN	2	79277821	missense	possibly damaging	0.88
IGL03008:Itga4	APN	2	79325638	missense	probably benign
IGL03282:Itga4	APN	2	79325594	missense	probably damaging	0.98
IGL03285:Itga4	APN	2	79279166	missense	possibly damaging	0.48
IGL03286:Itga4	APN	2	79289362	missense	probably damaging	1.00
R0001:Itga4	UTSW	2	79326587	missense	probably damaging	0.99
R0045:Itga4	UTSW	2	79301031	missense	probably damaging	1.00
R0276:Itga4	UTSW	2	79321493	missense	probably damaging	0.99
R0554:Itga4	UTSW	2	79279117	missense	probably damaging	1.00
R0556:Itga4	UTSW	2	79325639	missense	probably benign
R0785:Itga4	UTSW	2	79289305	missense	possibly damaging	0.89
R0787:Itga4	UTSW	2	79279153	missense	probably benign	0.01
R1013:Itga4	UTSW	2	79320503	missense	probably benign	0.00
R1237:Itga4	UTSW	2	79279146	missense	probably null	0.08
R1295:Itga4	UTSW	2	79322689	missense	possibly damaging	0.82
R1471:Itga4	UTSW	2	79287032	missense	probably benign	0.26
R1559:Itga4	UTSW	2	79315688	missense	probably benign	0.04
R1931:Itga4	UTSW	2	79313844	critical splice donor site	probably null
R2012:Itga4	UTSW	2	79277794	missense	probably damaging	1.00
R2241:Itga4	UTSW	2	79301013	missense	probably damaging	1.00
R3793:Itga4	UTSW	2	79279128	missense	probably benign	0.01
R4133:Itga4	UTSW	2	79322652	missense	probably damaging	1.00
R4204:Itga4	UTSW	2	79279161	missense	probably damaging	0.97
R4296:Itga4	UTSW	2	79272799	missense	probably damaging	1.00
R4777:Itga4	UTSW	2	79313710	missense	possibly damaging	0.87
R4906:Itga4	UTSW	2	79288248	missense	probably damaging	1.00
R5048:Itga4	UTSW	2	79273034	missense	probably benign	0.04
R5087:Itga4	UTSW	2	79315629	missense	possibly damaging	0.95
R5212:Itga4	UTSW	2	79280595	missense	probably damaging	1.00
R5213:Itga4	UTSW	2	79320576	missense	probably benign	0.29
R5421:Itga4	UTSW	2	79316041	nonsense	probably null
R5549:Itga4	UTSW	2	79256267	missense	probably damaging	0.98
R5907:Itga4	UTSW	2	79322656	missense	probably benign
R5917:Itga4	UTSW	2	79287098	missense	probably damaging	1.00
R6309:Itga4	UTSW	2	79279085	missense	probably damaging	1.00
R6764:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R6787:Itga4	UTSW	2	79289265	missense	probably damaging	0.97
R6790:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R7051:Itga4	UTSW	2	79318126	missense	possibly damaging	0.91
R7311:Itga4	UTSW	2	79256182	missense	probably benign
R7520:Itga4	UTSW	2	79300989	missense	probably damaging	1.00
R7573:Itga4	UTSW	2	79272993	missense	probably benign
R7636:Itga4	UTSW	2	79313832	missense	probably benign	0.01
R7889:Itga4	UTSW	2	79316045	missense	probably benign	0.05
R8123:Itga4	UTSW	2	79315683	missense	probably benign
R8284:Itga4	UTSW	2	79321439	missense	probably benign	0.00
R8445:Itga4	UTSW	2	79281781	missense	probably benign
R8553:Itga4	UTSW	2	79301061	missense	probably damaging	0.97
R8696:Itga4	UTSW	2	79281781	missense	probably benign
R8900:Itga4	UTSW	2	79314988	missense	probably damaging	1.00
R8922:Itga4	UTSW	2	79255594	utr 5 prime	probably benign
R9359:Itga4	UTSW	2	79325660	missense	possibly damaging	0.48
R9403:Itga4	UTSW	2	79325660	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- GCAAGCGTCCTCAACCAAGTTGTC -3'
(R):5'- CTCAGCATCAGAGAGCACTTACTGC -3'

Sequencing Primer
(F):5'- TGCCAGGCTTTACACTCAGAG -3'
(R):5'- GAGAGCACTTACTGCAAACTATG -3'

Posted On

2014-05-23