Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Ryr3'

194660

Institutional Source

Beutler Lab

Gene Symbol

Ryr3

Ensembl Gene

ENSMUSG00000057378

Gene Name

ryanodine receptor 3

Synonyms

calcium release channel isoform 3

MMRRC Submission

039800-MU

Accession Numbers

Genbank: NM_177652.2

Essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R1769 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112631355-113217096 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to C at 112751768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147250 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208151] [ENSMUST00000208290] [ENSMUST00000208290]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000080673

SMART Domains

Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
MIR	100	155	3.27e-4	SMART
MIR	162	207	7.52e-4	SMART
MIR	215	269	8.06e-4	SMART
MIR	275	368	8.4e-25	SMART
Pfam:RYDR_ITPR	438	642	1.1e-71	PFAM
SPRY	657	795	1.16e-24	SMART
Pfam:RyR	848	942	1.5e-34	PFAM
Pfam:RyR	962	1056	1.2e-32	PFAM
SPRY	1084	1207	7.99e-37	SMART
SPRY	1325	1465	6.25e-30	SMART
low complexity region	1757	1772	N/A	INTRINSIC
low complexity region	1773	1788	N/A	INTRINSIC
low complexity region	1932	1957	N/A	INTRINSIC
Pfam:RYDR_ITPR	2018	2228	1.8e-59	PFAM
Pfam:RyR	2595	2689	1.2e-36	PFAM
Pfam:RyR	2713	2801	2.1e-31	PFAM
low complexity region	2877	2887	N/A	INTRINSIC
low complexity region	3169	3184	N/A	INTRINSIC
low complexity region	3327	3338	N/A	INTRINSIC
PDB:2BCX\|B	3462	3491	9e-12	PDB
low complexity region	3532	3540	N/A	INTRINSIC
coiled coil region	3585	3614	N/A	INTRINSIC
Pfam:RIH_assoc	3715	3848	4.9e-40	PFAM
low complexity region	3855	3875	N/A	INTRINSIC
SCOP:d1sra__	3893	3989	1e-10	SMART
low complexity region	4096	4134	N/A	INTRINSIC
transmembrane domain	4178	4200	N/A	INTRINSIC
Pfam:RR_TM4-6	4227	4497	4.7e-96	PFAM
Pfam:Ion_trans	4599	4762	2e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000080673

SMART Domains

Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
MIR	100	155	3.27e-4	SMART
MIR	162	207	7.52e-4	SMART
MIR	215	269	8.06e-4	SMART
MIR	275	368	8.4e-25	SMART
Pfam:RYDR_ITPR	438	642	1.1e-71	PFAM
SPRY	657	795	1.16e-24	SMART
Pfam:RyR	848	942	1.5e-34	PFAM
Pfam:RyR	962	1056	1.2e-32	PFAM
SPRY	1084	1207	7.99e-37	SMART
SPRY	1325	1465	6.25e-30	SMART
low complexity region	1757	1772	N/A	INTRINSIC
low complexity region	1773	1788	N/A	INTRINSIC
low complexity region	1932	1957	N/A	INTRINSIC
Pfam:RYDR_ITPR	2018	2228	1.8e-59	PFAM
Pfam:RyR	2595	2689	1.2e-36	PFAM
Pfam:RyR	2713	2801	2.1e-31	PFAM
low complexity region	2877	2887	N/A	INTRINSIC
low complexity region	3169	3184	N/A	INTRINSIC
low complexity region	3327	3338	N/A	INTRINSIC
PDB:2BCX\|B	3462	3491	9e-12	PDB
low complexity region	3532	3540	N/A	INTRINSIC
coiled coil region	3585	3614	N/A	INTRINSIC
Pfam:RIH_assoc	3715	3848	4.9e-40	PFAM
low complexity region	3855	3875	N/A	INTRINSIC
SCOP:d1sra__	3893	3989	1e-10	SMART
low complexity region	4096	4134	N/A	INTRINSIC
transmembrane domain	4178	4200	N/A	INTRINSIC
Pfam:RR_TM4-6	4227	4497	4.7e-96	PFAM
Pfam:Ion_trans	4599	4762	2e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000091818

SMART Domains

Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378

Domain	Start	End	E-Value	Type
low complexity region	110	119	N/A	INTRINSIC
MIR	120	175	3.27e-4	SMART
MIR	182	227	7.52e-4	SMART
MIR	235	289	8.06e-4	SMART
MIR	295	388	8.4e-25	SMART
Pfam:RYDR_ITPR	460	655	1.2e-64	PFAM
SPRY	677	815	1.16e-24	SMART
Pfam:RyR	869	959	3.3e-38	PFAM
Pfam:RyR	983	1073	2.5e-32	PFAM
SPRY	1104	1227	7.99e-37	SMART
SPRY	1345	1485	6.25e-30	SMART
low complexity region	1777	1792	N/A	INTRINSIC
low complexity region	1793	1808	N/A	INTRINSIC
low complexity region	1952	1977	N/A	INTRINSIC
Pfam:RYDR_ITPR	2040	2248	5.8e-67	PFAM
Pfam:RyR	2616	2706	6.3e-33	PFAM
Pfam:RyR	2734	2818	6.6e-26	PFAM
low complexity region	2897	2907	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
PDB:2BCX\|B	3487	3516	1e-11	PDB
low complexity region	3557	3565	N/A	INTRINSIC
coiled coil region	3610	3639	N/A	INTRINSIC
Pfam:RIH_assoc	3744	3862	3.5e-34	PFAM
low complexity region	3880	3900	N/A	INTRINSIC
SCOP:d1sra__	3918	4014	1e-10	SMART
low complexity region	4121	4159	N/A	INTRINSIC
transmembrane domain	4203	4225	N/A	INTRINSIC
Pfam:RR_TM4-6	4252	4522	1.1e-98	PFAM
Pfam:Ion_trans	4625	4799	6.2e-16	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000134358

Predicted Effect

probably null
Transcript: ENSMUST00000134358

Predicted Effect

probably null
Transcript: ENSMUST00000208151

Predicted Effect

probably null
Transcript: ENSMUST00000208151

Predicted Effect

probably null
Transcript: ENSMUST00000208290

Predicted Effect

probably null
Transcript: ENSMUST00000208290

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Ryr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Ryr3	APN	2	112660149	missense	probably damaging	0.98
IGL00531:Ryr3	APN	2	112663012	splice site	probably benign
IGL00785:Ryr3	APN	2	112836103	missense	possibly damaging	0.95
IGL00901:Ryr3	APN	2	112886589	missense	probably damaging	1.00
IGL00910:Ryr3	APN	2	112728934	splice site	probably benign
IGL00970:Ryr3	APN	2	112764676	missense	probably damaging	1.00
IGL01083:Ryr3	APN	2	112751846	splice site	probably benign
IGL01105:Ryr3	APN	2	112751805	missense	probably damaging	1.00
IGL01287:Ryr3	APN	2	112709073	missense	probably damaging	1.00
IGL01343:Ryr3	APN	2	112660054	missense	probably damaging	1.00
IGL01472:Ryr3	APN	2	112672248	missense	probably benign	0.20
IGL01552:Ryr3	APN	2	112825883	missense	possibly damaging	0.53
IGL01594:Ryr3	APN	2	112772728	missense	probably damaging	1.00
IGL01723:Ryr3	APN	2	112650111	critical splice donor site	probably null
IGL01837:Ryr3	APN	2	112801320	missense	probably damaging	1.00
IGL01868:Ryr3	APN	2	112803158	splice site	probably benign
IGL01907:Ryr3	APN	2	112869001	splice site	probably benign
IGL02005:Ryr3	APN	2	112663263	splice site	probably benign
IGL02014:Ryr3	APN	2	112946915	missense	possibly damaging	0.86
IGL02109:Ryr3	APN	2	112949157	missense	probably benign
IGL02178:Ryr3	APN	2	112825799	missense	probably benign	0.17
IGL02185:Ryr3	APN	2	112967203	missense	probably damaging	0.99
IGL02189:Ryr3	APN	2	112754838	splice site	probably benign
IGL02200:Ryr3	APN	2	112849510	missense	probably damaging	0.98
IGL02302:Ryr3	APN	2	112964356	missense	probably damaging	1.00
IGL02305:Ryr3	APN	2	112645277	missense	probably damaging	0.96
IGL02306:Ryr3	APN	2	112834114	missense	probably damaging	0.98
IGL02306:Ryr3	APN	2	112847399	critical splice donor site	probably null
IGL02340:Ryr3	APN	2	112947004	splice site	probably benign
IGL02398:Ryr3	APN	2	112847422	missense	probably benign	0.05
IGL02407:Ryr3	APN	2	112754958	missense	probably damaging	1.00
IGL02426:Ryr3	APN	2	112900905	missense	possibly damaging	0.59
IGL02452:Ryr3	APN	2	112833990	missense	probably damaging	1.00
IGL02453:Ryr3	APN	2	112681728	splice site	probably benign
IGL02585:Ryr3	APN	2	112712303	missense	probably damaging	1.00
IGL02724:Ryr3	APN	2	112902576	critical splice donor site	probably null
IGL02817:Ryr3	APN	2	112844623	critical splice donor site	probably null
IGL02861:Ryr3	APN	2	112652841	missense	possibly damaging	0.89
IGL03038:Ryr3	APN	2	112668120	missense	possibly damaging	0.83
IGL03059:Ryr3	APN	2	112800047	missense	probably damaging	1.00
IGL03136:Ryr3	APN	2	112675974	splice site	probably benign
IGL03137:Ryr3	APN	2	112910397	missense	probably benign
IGL03166:Ryr3	APN	2	112641112	nonsense	probably null
IGL03177:Ryr3	APN	2	113028671	missense	probably benign	0.39
IGL03205:Ryr3	APN	2	112632142	missense	probably damaging	1.00
IGL03224:Ryr3	APN	2	112954336	nonsense	probably null
IGL03249:Ryr3	APN	2	112640656	missense	probably benign	0.32
IGL03370:Ryr3	APN	2	112756599	missense	possibly damaging	0.69
intruder	UTSW	2	112672246	nonsense	probably null
usurper	UTSW	2	112800022	missense	probably damaging	1.00
ANU74:Ryr3	UTSW	2	112831230	critical splice acceptor site	probably null
BB006:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
BB016:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
F5426:Ryr3	UTSW	2	112766338	splice site	probably benign
PIT4494001:Ryr3	UTSW	2	112841876	missense	probably damaging	0.99
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0085:Ryr3	UTSW	2	112859763	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0116:Ryr3	UTSW	2	112803165	missense	probably damaging	0.99
R0281:Ryr3	UTSW	2	112686810	missense	probably damaging	1.00
R0302:Ryr3	UTSW	2	112647123	splice site	probably benign
R0306:Ryr3	UTSW	2	112775655	critical splice donor site	probably null
R0445:Ryr3	UTSW	2	112866054	missense	probably benign	0.16
R0463:Ryr3	UTSW	2	112661701	missense	probably damaging	1.00
R0592:Ryr3	UTSW	2	112678481	missense	probably damaging	1.00
R0622:Ryr3	UTSW	2	112662555	missense	probably damaging	1.00
R0656:Ryr3	UTSW	2	112648306	splice site	probably benign
R0735:Ryr3	UTSW	2	112732982	missense	probably benign	0.11
R0783:Ryr3	UTSW	2	112756327	splice site	probably benign
R0789:Ryr3	UTSW	2	112780973	splice site	probably null
R0835:Ryr3	UTSW	2	112650138	missense	probably benign	0.16
R0879:Ryr3	UTSW	2	113030243	missense	probably benign	0.02
R0924:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0930:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0931:Ryr3	UTSW	2	112653702	missense	probably damaging	1.00
R1037:Ryr3	UTSW	2	112869108	missense	probably benign	0.42
R1169:Ryr3	UTSW	2	112733014	missense	probably benign	0.01
R1170:Ryr3	UTSW	2	112946987	missense	probably damaging	1.00
R1178:Ryr3	UTSW	2	112964380	missense	probably benign	0.00
R1187:Ryr3	UTSW	2	112958176	missense	probably damaging	1.00
R1289:Ryr3	UTSW	2	112645285	missense	probably damaging	1.00
R1337:Ryr3	UTSW	2	112779963	missense	possibly damaging	0.46
R1342:Ryr3	UTSW	2	112750803	missense	probably damaging	1.00
R1349:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1372:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1434:Ryr3	UTSW	2	112645259	missense	probably damaging	1.00
R1438:Ryr3	UTSW	2	112757701	missense	probably benign	0.18
R1467:Ryr3	UTSW	2	112753002	splice site	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1474:Ryr3	UTSW	2	112909962	missense	probably damaging	1.00
R1481:Ryr3	UTSW	2	112636522	splice site	probably benign
R1513:Ryr3	UTSW	2	112709197	nonsense	probably null
R1524:Ryr3	UTSW	2	112869082	missense	probably damaging	0.98
R1525:Ryr3	UTSW	2	112678090	missense	probably damaging	1.00
R1526:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R1611:Ryr3	UTSW	2	112653505	missense	possibly damaging	0.72
R1640:Ryr3	UTSW	2	112900833	missense	probably damaging	1.00
R1662:Ryr3	UTSW	2	112709273	missense	probably damaging	0.99
R1764:Ryr3	UTSW	2	112860460	missense	probably damaging	1.00
R1776:Ryr3	UTSW	2	112957253	missense	probably damaging	0.99
R1780:Ryr3	UTSW	2	112867292	missense	probably damaging	0.98
R1840:Ryr3	UTSW	2	112750820	missense	probably damaging	1.00
R1864:Ryr3	UTSW	2	112730328	missense	possibly damaging	0.65
R1872:Ryr3	UTSW	2	112709137	missense	possibly damaging	0.94
R1960:Ryr3	UTSW	2	112794467	missense	probably damaging	1.00
R1994:Ryr3	UTSW	2	112654492	missense	probably null	0.93
R2018:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2019:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2029:Ryr3	UTSW	2	112647016	missense	possibly damaging	0.82
R2051:Ryr3	UTSW	2	112756641	missense	probably damaging	1.00
R2060:Ryr3	UTSW	2	112954364	missense	possibly damaging	0.92
R2061:Ryr3	UTSW	2	112663004	missense	possibly damaging	0.83
R2067:Ryr3	UTSW	2	112946957	missense	probably damaging	1.00
R2106:Ryr3	UTSW	2	112638129	missense	probably damaging	1.00
R2129:Ryr3	UTSW	2	112678370	splice site	probably benign
R2140:Ryr3	UTSW	2	112875148	missense	probably benign	0.01
R2176:Ryr3	UTSW	2	112666335	missense	possibly damaging	0.48
R2241:Ryr3	UTSW	2	112801392	missense	probably damaging	1.00
R2261:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2262:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2276:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2279:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2403:Ryr3	UTSW	2	112686628	missense	probably damaging	1.00
R2510:Ryr3	UTSW	2	112675904	missense	probably benign	0.18
R2568:Ryr3	UTSW	2	112675874	missense	probably damaging	1.00
R3013:Ryr3	UTSW	2	112640281	missense	probably damaging	1.00
R3431:Ryr3	UTSW	2	112656531	missense	probably damaging	1.00
R3552:Ryr3	UTSW	2	112751787	missense	probably damaging	1.00
R3761:Ryr3	UTSW	2	112754913	missense	probably benign
R3909:Ryr3	UTSW	2	112636608	missense	probably damaging	1.00
R3923:Ryr3	UTSW	2	112841873	missense	possibly damaging	0.92
R3924:Ryr3	UTSW	2	113028703	splice site	probably benign
R3927:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3947:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3949:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3976:Ryr3	UTSW	2	112675837	missense	possibly damaging	0.49
R4004:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4022:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4084:Ryr3	UTSW	2	112900908	missense	probably damaging	0.99
R4106:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4108:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4109:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4131:Ryr3	UTSW	2	112926983	splice site	probably null
R4156:Ryr3	UTSW	2	112653675	missense	probably damaging	1.00
R4172:Ryr3	UTSW	2	112794470	missense	probably damaging	1.00
R4234:Ryr3	UTSW	2	112910407	missense	probably damaging	1.00
R4399:Ryr3	UTSW	2	112946844	missense	probably benign	0.01
R4409:Ryr3	UTSW	2	112730308	missense	probably damaging	1.00
R4418:Ryr3	UTSW	2	112831224	missense	probably damaging	1.00
R4466:Ryr3	UTSW	2	112653102	missense	possibly damaging	0.92
R4525:Ryr3	UTSW	2	112653621	missense	probably damaging	0.98
R4573:Ryr3	UTSW	2	112755174	splice site	probably null
R4589:Ryr3	UTSW	2	112875133	missense	probably damaging	1.00
R4653:Ryr3	UTSW	2	112652763	missense	probably damaging	1.00
R4664:Ryr3	UTSW	2	112996555	intron	probably benign
R4710:Ryr3	UTSW	2	112766301	missense	probably damaging	1.00
R4734:Ryr3	UTSW	2	112910502	missense	probably damaging	0.99
R4741:Ryr3	UTSW	2	112803268	missense	probably damaging	0.99
R4748:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4749:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4754:Ryr3	UTSW	2	112757639	missense	possibly damaging	0.94
R4764:Ryr3	UTSW	2	112733031	critical splice acceptor site	probably null
R4812:Ryr3	UTSW	2	112912236	missense	probably damaging	1.00
R4822:Ryr3	UTSW	2	112652745	missense	probably damaging	1.00
R4841:Ryr3	UTSW	2	112648373	missense	probably damaging	1.00
R4849:Ryr3	UTSW	2	112908462	missense	probably damaging	1.00
R4917:Ryr3	UTSW	2	112831185	missense	probably damaging	1.00
R4942:Ryr3	UTSW	2	112836257	missense	probably damaging	0.99
R4990:Ryr3	UTSW	2	112635777	missense	probably damaging	1.00
R4990:Ryr3	UTSW	2	112909973	missense	probably damaging	1.00
R5049:Ryr3	UTSW	2	112640171	missense	probably damaging	1.00
R5055:Ryr3	UTSW	2	112831159	missense	probably benign	0.00
R5112:Ryr3	UTSW	2	112902665	missense	probably damaging	1.00
R5160:Ryr3	UTSW	2	112646927	missense	probably damaging	1.00
R5169:Ryr3	UTSW	2	112670660	missense	possibly damaging	0.63
R5176:Ryr3	UTSW	2	112757667	missense	possibly damaging	0.95
R5182:Ryr3	UTSW	2	112755150	missense	probably damaging	1.00
R5206:Ryr3	UTSW	2	112844711	missense	probably damaging	1.00
R5263:Ryr3	UTSW	2	112718002	missense	possibly damaging	0.65
R5272:Ryr3	UTSW	2	112653213	missense	probably damaging	1.00
R5332:Ryr3	UTSW	2	112902693	missense	probably damaging	1.00
R5340:Ryr3	UTSW	2	112834125	missense	probably damaging	0.99
R5359:Ryr3	UTSW	2	112775841	splice site	probably null
R5434:Ryr3	UTSW	2	112794469	missense	probably damaging	1.00
R5454:Ryr3	UTSW	2	112730302	splice site	probably null
R5501:Ryr3	UTSW	2	112662504	missense	possibly damaging	0.80
R5560:Ryr3	UTSW	2	112754877	missense	probably damaging	1.00
R5580:Ryr3	UTSW	2	112841948	missense	probably damaging	1.00
R5621:Ryr3	UTSW	2	112900984	nonsense	probably null
R5731:Ryr3	UTSW	2	112641572	missense	probably damaging	1.00
R5757:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5758:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5768:Ryr3	UTSW	2	112753097	missense	probably benign	0.05
R5783:Ryr3	UTSW	2	112652998	missense	probably benign	0.06
R5799:Ryr3	UTSW	2	112686580	missense	probably damaging	1.00
R5829:Ryr3	UTSW	2	112859731	missense	probably damaging	1.00
R5883:Ryr3	UTSW	2	113030292	intron	probably benign
R5911:Ryr3	UTSW	2	112908487	missense	probably damaging	1.00
R5968:Ryr3	UTSW	2	112647049	missense	probably benign	0.22
R5972:Ryr3	UTSW	2	112834064	missense	probably damaging	0.99
R5978:Ryr3	UTSW	2	112672269	missense	probably benign	0.00
R6084:Ryr3	UTSW	2	112908493	missense	probably damaging	1.00
R6117:Ryr3	UTSW	2	112635396	missense	probably damaging	1.00
R6126:Ryr3	UTSW	2	112757670	missense	probably damaging	1.00
R6128:Ryr3	UTSW	2	112954294	critical splice donor site	probably null
R6157:Ryr3	UTSW	2	112841899	missense	probably damaging	0.98
R6258:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6260:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6373:Ryr3	UTSW	2	112656544	missense	probably damaging	1.00
R6377:Ryr3	UTSW	2	112632185	missense	probably damaging	1.00
R6443:Ryr3	UTSW	2	112675933	missense	possibly damaging	0.88
R6478:Ryr3	UTSW	2	112660068	missense	probably damaging	1.00
R6512:Ryr3	UTSW	2	112867378	missense	possibly damaging	0.83
R6684:Ryr3	UTSW	2	112753088	missense	probably damaging	1.00
R6753:Ryr3	UTSW	2	112652610	missense	probably damaging	0.99
R6812:Ryr3	UTSW	2	112946906	missense	probably damaging	1.00
R6910:Ryr3	UTSW	2	112958175	missense	probably damaging	1.00
R6930:Ryr3	UTSW	2	112860354	missense	probably damaging	1.00
R6946:Ryr3	UTSW	2	112831200	missense	probably damaging	1.00
R6950:Ryr3	UTSW	2	112686825	missense	possibly damaging	0.78
R6973:Ryr3	UTSW	2	112766311	missense	probably damaging	0.99
R6984:Ryr3	UTSW	2	112875091	missense	probably damaging	1.00
R7020:Ryr3	UTSW	2	112753078	missense	probably benign	0.00
R7037:Ryr3	UTSW	2	112949130	nonsense	probably null
R7166:Ryr3	UTSW	2	112875028	missense	probably damaging	1.00
R7172:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R7177:Ryr3	UTSW	2	112900843	missense	probably damaging	1.00
R7188:Ryr3	UTSW	2	113028644	missense	probably damaging	1.00
R7202:Ryr3	UTSW	2	112766319	missense	probably damaging	1.00
R7228:Ryr3	UTSW	2	112861852	missense	probably damaging	1.00
R7256:Ryr3	UTSW	2	112672246	nonsense	probably null
R7293:Ryr3	UTSW	2	112902603	missense	probably benign	0.13
R7331:Ryr3	UTSW	2	112763665	missense	possibly damaging	0.80
R7380:Ryr3	UTSW	2	112640157	missense	probably damaging	1.00
R7391:Ryr3	UTSW	2	112780977	critical splice donor site	probably null
R7455:Ryr3	UTSW	2	112728866	missense	probably damaging	0.99
R7466:Ryr3	UTSW	2	112926957	missense	probably benign	0.40
R7481:Ryr3	UTSW	2	112678093	missense	probably benign	0.16
R7481:Ryr3	UTSW	2	112678094	missense	possibly damaging	0.95
R7497:Ryr3	UTSW	2	112730473	missense	probably benign	0.06
R7502:Ryr3	UTSW	2	112712361	missense	probably benign	0.00
R7505:Ryr3	UTSW	2	112712429	missense	probably damaging	0.99
R7581:Ryr3	UTSW	2	112753027	missense	probably damaging	0.99
R7606:Ryr3	UTSW	2	112645245	nonsense	probably null
R7677:Ryr3	UTSW	2	112833900	missense	probably benign
R7703:Ryr3	UTSW	2	112859765	missense	probably damaging	1.00
R7713:Ryr3	UTSW	2	112635346	missense	probably benign	0.12
R7784:Ryr3	UTSW	2	112775695	missense	probably damaging	1.00
R7831:Ryr3	UTSW	2	112926838	missense	possibly damaging	0.92
R7851:Ryr3	UTSW	2	112678517	missense	probably benign	0.05
R7873:Ryr3	UTSW	2	112730428	missense	probably benign	0.28
R7890:Ryr3	UTSW	2	112926912	missense	probably damaging	1.00
R7899:Ryr3	UTSW	2	112646950	missense	possibly damaging	0.86
R7904:Ryr3	UTSW	2	112781024	missense	probably damaging	1.00
R7929:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
R7982:Ryr3	UTSW	2	112669249	small deletion	probably benign
R8018:Ryr3	UTSW	2	112678432	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112775664	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112875077	missense	probably damaging	1.00
R8095:Ryr3	UTSW	2	112668043	critical splice donor site	probably null
R8097:Ryr3	UTSW	2	112670270	splice site	probably null
R8181:Ryr3	UTSW	2	112778243	missense	probably damaging	0.98
R8276:Ryr3	UTSW	2	112640617	missense	probably damaging	1.00
R8329:Ryr3	UTSW	2	112662510	missense	possibly damaging	0.94
R8345:Ryr3	UTSW	2	112652925	missense	probably benign	0.01
R8361:Ryr3	UTSW	2	112653130	missense	probably damaging	0.98
R8421:Ryr3	UTSW	2	112996584	missense	probably benign	0.00
R8424:Ryr3	UTSW	2	112841894	missense	possibly damaging	0.91
R8471:Ryr3	UTSW	2	112653780	missense	probably damaging	1.00
R8505:Ryr3	UTSW	2	112675870	missense	probably damaging	0.98
R8535:Ryr3	UTSW	2	112949088	critical splice donor site	probably null
R8540:Ryr3	UTSW	2	112800022	missense	probably damaging	1.00
R8722:Ryr3	UTSW	2	112772771	missense	probably benign	0.12
R8818:Ryr3	UTSW	2	112831096	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8820:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8820:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8852:Ryr3	UTSW	2	112794499	missense	probably damaging	1.00
R8859:Ryr3	UTSW	2	112653219	missense	probably damaging	0.98
R8896:Ryr3	UTSW	2	112753050	nonsense	probably null
R8916:Ryr3	UTSW	2	112778290	missense	probably damaging	1.00
R8935:Ryr3	UTSW	2	112678057	missense	probably benign	0.33
R8943:Ryr3	UTSW	2	112635324	missense	probably damaging	1.00
R8963:Ryr3	UTSW	2	112836670	critical splice donor site	probably null
R8974:Ryr3	UTSW	2	112912279	missense	possibly damaging	0.74
R9008:Ryr3	UTSW	2	112635403	missense	probably damaging	0.98
R9040:Ryr3	UTSW	2	112954386	missense	probably damaging	1.00
R9041:Ryr3	UTSW	2	112957201	missense	probably damaging	0.97
R9102:Ryr3	UTSW	2	112678561	splice site	probably benign
R9167:Ryr3	UTSW	2	112834053	missense	probably damaging	1.00
R9180:Ryr3	UTSW	2	112661636	missense	probably damaging	0.99
R9219:Ryr3	UTSW	2	112912239	missense	possibly damaging	0.62
R9258:Ryr3	UTSW	2	112653019	missense	probably damaging	0.99
R9300:Ryr3	UTSW	2	112860350	missense	probably benign
R9320:Ryr3	UTSW	2	112779991	missense	probably damaging	1.00
R9325:Ryr3	UTSW	2	112649295	missense	probably damaging	0.96
R9405:Ryr3	UTSW	2	112834267	missense	probably damaging	1.00
R9414:Ryr3	UTSW	2	112670666	missense	possibly damaging	0.81
R9489:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9522:Ryr3	UTSW	2	112730414	missense	probably benign	0.34
R9526:Ryr3	UTSW	2	112833925	missense	probably benign
R9529:Ryr3	UTSW	2	112635315	missense	possibly damaging	0.70
R9605:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9652:Ryr3	UTSW	2	112804702	missense	possibly damaging	0.66
R9660:Ryr3	UTSW	2	112833729	missense	probably benign
R9670:Ryr3	UTSW	2	112730500	missense	probably benign	0.28
R9673:Ryr3	UTSW	2	112656538	missense	possibly damaging	0.93
R9710:Ryr3	UTSW	2	112803189	missense	probably damaging	0.99
R9741:Ryr3	UTSW	2	112646926	missense	probably benign	0.00
R9772:Ryr3	UTSW	2	112826703	missense	probably damaging	0.96
RF010:Ryr3	UTSW	2	112775670	missense	probably damaging	0.97
RF040:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
RF044:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
X0057:Ryr3	UTSW	2	112640159	missense	probably damaging	1.00
X0064:Ryr3	UTSW	2	112912302	missense	probably benign	0.26
Z1088:Ryr3	UTSW	2	112900916	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112675920	missense	probably benign	0.05
Z1176:Ryr3	UTSW	2	112712374	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112728924	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCTTTACACACCAGTTTCCCACAG -3'
(R):5'- AGCAACTAGGCTTGCTCCTTGAC -3'

Sequencing Primer
(F):5'- TTGTTTGGAGCACACTAGCAAG -3'
(R):5'- AGGCTTGCTCCTTGACTTTTTG -3'

Posted On

2014-05-23