Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Itch'

194665

Institutional Source

Beutler Lab

Gene Symbol

Itch

Ensembl Gene

ENSMUSG00000027598

Gene Name

itchy, E3 ubiquitin protein ligase

Synonyms

8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4

MMRRC Submission

039800-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1769 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155133509-155226855 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155172561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 106 (L106S)

Ref Sequence

ENSEMBL: ENSMUSP00000105307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]

AlphaFold

Q8C863

Predicted Effect

probably damaging
Transcript: ENSMUST00000029126
AA Change: L106S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: L106S

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109685
AA Change: L106S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: L106S

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138468

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142147

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155360

Meta Mutation Damage Score

0.9122

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Itch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Itch	APN	2	155213023	missense	probably damaging	1.00
IGL00796:Itch	APN	2	155209082	missense	probably damaging	0.97
IGL01090:Itch	APN	2	155206336	missense	probably damaging	0.99
IGL01568:Itch	APN	2	155212462	splice site	probably benign
IGL01844:Itch	APN	2	155172547	missense	possibly damaging	0.56
IGL01844:Itch	APN	2	155172486	missense	possibly damaging	0.94
IGL01873:Itch	APN	2	155168750	missense	possibly damaging	0.68
IGL02129:Itch	APN	2	155217988	splice site	probably benign
IGL02386:Itch	APN	2	155202261	nonsense	probably null
IGL02545:Itch	APN	2	155172586	splice site	probably null
IGL02621:Itch	APN	2	155172584	splice site	probably null
IGL02708:Itch	APN	2	155174044	missense	probably benign	0.00
IGL02869:Itch	APN	2	155173933	critical splice acceptor site	probably null
Abrade	UTSW	2	155209078	missense	possibly damaging	0.93
dorsolateral	UTSW	2	155210558	nonsense	probably null
gadfly	UTSW	2	155182298	nonsense	probably null
hankerin	UTSW	2	155210582	critical splice donor site	probably null
irresistable	UTSW	2	155203297	missense	probably benign	0.34
prurient	UTSW	2	155210502	missense	probably damaging	1.00
scratch	UTSW	2	155172561	missense	probably damaging	0.99
R0116:Itch	UTSW	2	155217983	splice site	probably benign
R0207:Itch	UTSW	2	155202257	missense	probably benign
R0226:Itch	UTSW	2	155199394	missense	probably benign	0.01
R0545:Itch	UTSW	2	155182298	nonsense	probably null
R0689:Itch	UTSW	2	155182178	missense	possibly damaging	0.82
R1365:Itch	UTSW	2	155213031	missense	probably benign	0.00
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1436:Itch	UTSW	2	155192145	missense	probably damaging	0.96
R1639:Itch	UTSW	2	155179025	splice site	probably null
R1855:Itch	UTSW	2	155172454	splice site	probably benign
R1865:Itch	UTSW	2	155168746	missense	probably damaging	0.96
R2008:Itch	UTSW	2	155210459	missense	possibly damaging	0.91
R2054:Itch	UTSW	2	155210576	missense	probably damaging	1.00
R2196:Itch	UTSW	2	155202221	missense	probably benign
R2199:Itch	UTSW	2	155202221	missense	probably benign
R2252:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2253:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2348:Itch	UTSW	2	155209078	missense	possibly damaging	0.93
R2850:Itch	UTSW	2	155202221	missense	probably benign
R3021:Itch	UTSW	2	155209126	missense	possibly damaging	0.74
R4676:Itch	UTSW	2	155199435	missense	probably benign	0.05
R4716:Itch	UTSW	2	155210582	critical splice donor site	probably null
R4888:Itch	UTSW	2	155217977	splice site	probably null
R4970:Itch	UTSW	2	155185593	missense	possibly damaging	0.50
R6029:Itch	UTSW	2	155179089	critical splice donor site	probably null
R6122:Itch	UTSW	2	155174065	missense	probably benign	0.05
R6435:Itch	UTSW	2	155209129	missense	probably benign	0.01
R6449:Itch	UTSW	2	155163395	splice site	probably benign
R7069:Itch	UTSW	2	155209994	missense	probably damaging	1.00
R7083:Itch	UTSW	2	155210444	missense	probably damaging	1.00
R7409:Itch	UTSW	2	155199382	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155210002	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155213067	missense	probably benign	0.00
R7974:Itch	UTSW	2	155192159	missense	probably damaging	1.00
R8046:Itch	UTSW	2	155210502	missense	probably damaging	1.00
R8248:Itch	UTSW	2	155206383	critical splice donor site	probably null
R8355:Itch	UTSW	2	155210582	critical splice donor site	probably null
R8428:Itch	UTSW	2	155168707	missense	probably benign	0.38
R8691:Itch	UTSW	2	155210558	nonsense	probably null
R8779:Itch	UTSW	2	155172520	missense	probably benign	0.28
R9010:Itch	UTSW	2	155179071	missense	probably benign
R9130:Itch	UTSW	2	155210125	splice site	probably benign
R9278:Itch	UTSW	2	155203297	missense	probably benign	0.34
Z1177:Itch	UTSW	2	155209059	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGAATAGTAAACTTTAGGACGCGCA -3'
(R):5'- tctctccagcaccCTATGCCTTT -3'

Sequencing Primer
(F):5'- gccagcctctaatactgatgac -3'
(R):5'- tctatctgcctctgcttccc -3'

Posted On

2014-05-23