Incidental Mutation 'R1769:Ccdc39'
ID 194667
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Name coiled-coil domain containing 39
Synonyms b2b2025.1Clo, b2b1735Clo, 4921507O14Rik, D3Ertd789e, b2b1304Clo
MMRRC Submission 039800-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock # R1769 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 33812362-33844310 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33826480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 446 (K446R)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222]
AlphaFold Q9D5Y1
Predicted Effect probably damaging
Transcript: ENSMUST00000029222
AA Change: K446R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: K446R

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200551
Meta Mutation Damage Score 0.1563 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33832568 missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33816958 unclassified probably benign
IGL02426:Ccdc39 APN 3 33825398 missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33825494 missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33830118 missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33837843 missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33819839 missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33844125 missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33815485 missense probably benign 0.34
R1370:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33821412 missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33839145 missense possibly damaging 0.60
R1965:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33819896 missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33815501 missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33821432 missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33836733 missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33841178 missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33815484 missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33837838 missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33814497 missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33825479 missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33837882 missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33826522 missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33819806 critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33813078 missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33839093 splice site probably null
R5236:Ccdc39 UTSW 3 33830102 missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33825550 missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33816937 missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33826561 missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33841192 splice site probably null
R6375:Ccdc39 UTSW 3 33814367 missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33837959 missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33830093 missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33819868 missense probably damaging 1.00
R7183:Ccdc39 UTSW 3 33814471 missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33830105 missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33832676 missense possibly damaging 0.55
R7645:Ccdc39 UTSW 3 33825169 splice site probably null
R7695:Ccdc39 UTSW 3 33814519 missense probably damaging 1.00
R7752:Ccdc39 UTSW 3 33832617 missense possibly damaging 0.55
R8487:Ccdc39 UTSW 3 33832659 nonsense probably null
R8523:Ccdc39 UTSW 3 33815411 critical splice donor site probably null
R8525:Ccdc39 UTSW 3 33814704 missense probably benign 0.00
R8777:Ccdc39 UTSW 3 33839133 missense probably benign
R8777-TAIL:Ccdc39 UTSW 3 33839133 missense probably benign
R8842:Ccdc39 UTSW 3 33826463 missense probably damaging 1.00
R8932:Ccdc39 UTSW 3 33830125 missense probably benign 0.00
R9207:Ccdc39 UTSW 3 33832557 nonsense probably null
R9280:Ccdc39 UTSW 3 33816004 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCCAGGTCCTTTAACACACAGTC -3'
(R):5'- TGCCAACCTTGTCTACCAGCAC -3'

Sequencing Primer
(F):5'- ACAGTAGTAGCTTTTAAGACCCTCTC -3'
(R):5'- TTGTCTACCAGCACTGGAGATAAG -3'
Posted On 2014-05-23