Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Kirrel'

194671

Institutional Source

Beutler Lab

Gene Symbol

Kirrel

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

Kirrel1, 6720469N11Rik, Neph1

MMRRC Submission

039800-MU

Accession Numbers

Genbank: NM_130867; MGI: 1891396

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1769 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

87078593-87174747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87089151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Kirrel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel	APN	3	87089875	missense	probably benign	0.22
IGL01865:Kirrel	APN	3	87086424	missense	probably damaging	1.00
IGL01875:Kirrel	APN	3	87095730	missense	probably damaging	1.00
IGL02337:Kirrel	APN	3	87089212	missense	possibly damaging	0.64
IGL02724:Kirrel	APN	3	87090473	nonsense	probably null
IGL02825:Kirrel	APN	3	87089288	splice site	probably benign
IGL02826:Kirrel	APN	3	87088485	missense	probably damaging	1.00
IGL03102:Kirrel	APN	3	87083500	missense	probably damaging	0.98
D4043:Kirrel	UTSW	3	87083203	missense	probably benign	0.02
R0360:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0364:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0421:Kirrel	UTSW	3	87083607	missense	probably damaging	0.99
R0503:Kirrel	UTSW	3	87097802	missense	probably benign	0.20
R1112:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1116:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1144:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1190:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1226:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1501:Kirrel	UTSW	3	87090472	missense	probably benign	0.02
R1538:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1546:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1628:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1630:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1631:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1664:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1671:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1695:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1807:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1808:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1840:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1995:Kirrel	UTSW	3	87095786	missense	possibly damaging	0.88
R2014:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2086:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2108:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2354:Kirrel	UTSW	3	87088485	missense	probably damaging	0.98
R2407:Kirrel	UTSW	3	87084843	missense	probably benign	0.03
R2904:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2905:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2958:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2959:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2960:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2961:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3026:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3028:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3034:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R3149:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3195:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3196:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3499:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3699:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3720:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3721:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3788:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3793:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3877:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3901:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3910:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3911:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3912:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3913:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3930:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3931:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4022:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4067:Kirrel	UTSW	3	87088467	nonsense	probably null
R4077:Kirrel	UTSW	3	87085080	critical splice donor site	probably null
R4198:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4328:Kirrel	UTSW	3	87084774	intron	probably benign
R4355:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4363:Kirrel	UTSW	3	87090485	nonsense	probably null
R4378:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4386:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4460:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4468:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4469:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4650:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4652:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4734:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4748:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4749:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R5304:Kirrel	UTSW	3	87089595	missense	probably benign	0.02
R5534:Kirrel	UTSW	3	87090518	missense	probably damaging	1.00
R5604:Kirrel	UTSW	3	87089155	missense	possibly damaging	0.69
R7199:Kirrel	UTSW	3	87083388	missense	probably benign	0.02
R7221:Kirrel	UTSW	3	87086397	nonsense	probably null
R7284:Kirrel	UTSW	3	87083387	missense	probably benign	0.02
R7332:Kirrel	UTSW	3	87088398	missense	probably benign	0.14
R7369:Kirrel	UTSW	3	87141084	missense	probably benign	0.20
R7371:Kirrel	UTSW	3	87088422	missense	probably benign	0.44
R7508:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R7566:Kirrel	UTSW	3	87088484	missense	probably damaging	1.00
R7567:Kirrel	UTSW	3	87095681	missense	probably damaging	0.99
R7621:Kirrel	UTSW	3	87088221	missense	possibly damaging	0.70
R8030:Kirrel	UTSW	3	87097775	missense	probably damaging	1.00
R8141:Kirrel	UTSW	3	87086428	nonsense	probably null
R8261:Kirrel	UTSW	3	87088002	intron	probably benign
R8477:Kirrel	UTSW	3	87084831	missense	possibly damaging	0.71
R8512:Kirrel	UTSW	3	87088227	missense	probably benign	0.00
R8954:Kirrel	UTSW	3	87089866	missense	probably benign	0.25
R8987:Kirrel	UTSW	3	87085093	missense	probably damaging	1.00
R9058:Kirrel	UTSW	3	87085135	missense	probably benign	0.18
R9146:Kirrel	UTSW	3	87095708	missense	probably damaging	1.00
R9311:Kirrel	UTSW	3	87097816	missense	probably benign	0.29
R9527:Kirrel	UTSW	3	87089605	nonsense	probably null
R9629:Kirrel	UTSW	3	87095718	nonsense	probably null
Z1177:Kirrel	UTSW	3	87083875	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTATGGCTGACTGCAAGTACCCTC -3'
(R):5'- GGGACGAAAACTCCACTAACCTGG -3'

Sequencing Primer
(F):5'- GACTGCAAGTACCCTCTTTCC -3'
(R):5'- AGCTGATGATTCTCAGGCAC -3'

Posted On

2014-05-23