Incidental Mutation 'R1769:Pde4dip'
ID194672
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 039800-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97695930 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2248 (S2248P)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
Predicted Effect probably benign
Transcript: ENSMUST00000090750
AA Change: S2248P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: S2248P

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168438
AA Change: S2197P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: S2197P

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200063
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTACTCAAGGGCAGAGCAATGAC -3'
(R):5'- TGCGAACCCATTCATTCCACGG -3'

Sequencing Primer
(F):5'- CCAAGGCAGAGGACTGTGC -3'
(R):5'- gaaccCATTCATTCCACGGTAAAC -3'
Posted On2014-05-23