Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Plch2'

194679

Institutional Source

Beutler Lab

Gene Symbol

Plch2

Ensembl Gene

ENSMUSG00000029055

Gene Name

phospholipase C, eta 2

Synonyms

Plcl4, A930027K05Rik, PLCeta2

MMRRC Submission

039800-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1769 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154983115-155056784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155000083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 379 (Y379C)

Ref Sequence

ENSEMBL: ENSMUSP00000134750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000145662] [ENSMUST00000176194] [ENSMUST00000186598]

AlphaFold

A2AP18

Predicted Effect

probably damaging
Transcript: ENSMUST00000105631
AA Change: Y480C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: Y480C

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	1.7e-26	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1088	1107	N/A	INTRINSIC
low complexity region	1227	1236	N/A	INTRINSIC
low complexity region	1356	1369	N/A	INTRINSIC
low complexity region	1421	1451	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127661

Predicted Effect

probably damaging
Transcript: ENSMUST00000135665
AA Change: Y375C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: Y375C

Domain	Start	End	E-Value	Type
PH	17	126	1.8e-6	SMART
EFh	142	170	7.29e-4	SMART
EFh	178	207	4.67e-2	SMART
Pfam:EF-hand_like	212	294	2.8e-25	PFAM
PLCXc	295	440	6.76e-76	SMART
low complexity region	454	467	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
PLCYc	602	716	1.25e-56	SMART
C2	735	843	1.66e-21	SMART
low complexity region	983	1002	N/A	INTRINSIC
low complexity region	1122	1131	N/A	INTRINSIC
low complexity region	1251	1264	N/A	INTRINSIC
low complexity region	1316	1346	N/A	INTRINSIC
low complexity region	1349	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139976
AA Change: Y480C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: Y480C

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	3.2e-27	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1087	1100	N/A	INTRINSIC
low complexity region	1166	1194	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000145662
AA Change: Y404C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119864
Gene: ENSMUSG00000029055
AA Change: Y404C

Domain	Start	End	E-Value	Type
PH	46	155	1.8e-6	SMART
EFh	171	199	7.29e-4	SMART
EFh	207	236	4.67e-2	SMART
Pfam:EF-hand_like	241	323	5.2e-27	PFAM
PLCXc	324	469	6.76e-76	SMART
low complexity region	483	496	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175982
AA Change: Y264C

Predicted Effect

probably damaging
Transcript: ENSMUST00000176194
AA Change: Y379C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: Y379C

Domain	Start	End	E-Value	Type
PH	21	130	1.8e-6	SMART
EFh	146	174	7.29e-4	SMART
EFh	182	211	4.67e-2	SMART
Pfam:EF-hand_like	216	298	1.6e-25	PFAM
PLCXc	299	444	6.76e-76	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	558	575	N/A	INTRINSIC
PLCYc	606	720	1.25e-56	SMART
C2	739	847	1.66e-21	SMART
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1065	1093	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186598

SMART Domains

Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	79	189	5.8e-18	SMART
low complexity region	328	341	N/A	INTRINSIC
low complexity region	407	435	N/A	INTRINSIC

Meta Mutation Damage Score

0.7385

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Plch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Plch2	APN	4	155006642	missense	probably damaging	1.00
IGL02024:Plch2	APN	4	155043138	intron	probably benign
IGL02580:Plch2	APN	4	154984764	missense	probably benign	0.03
IGL03370:Plch2	APN	4	154986914	missense	probably benign	0.18
IGL03407:Plch2	APN	4	154989798	missense	probably damaging	1.00
tolerant	UTSW	4	154984635	missense	probably benign	0.01
PIT4418001:Plch2	UTSW	4	154989503	missense	probably damaging	1.00
PIT4445001:Plch2	UTSW	4	155009026	missense	probably damaging	1.00
R0117:Plch2	UTSW	4	154985358	unclassified	probably benign
R0347:Plch2	UTSW	4	154986721	missense	possibly damaging	0.91
R0361:Plch2	UTSW	4	155006711	missense	possibly damaging	0.95
R0413:Plch2	UTSW	4	155006916	critical splice donor site	probably null
R0487:Plch2	UTSW	4	155009012	missense	probably damaging	1.00
R0514:Plch2	UTSW	4	154998886	missense	probably damaging	1.00
R0734:Plch2	UTSW	4	154996283	missense	probably damaging	1.00
R0766:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1306:Plch2	UTSW	4	155007140	missense	probably damaging	1.00
R1312:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1602:Plch2	UTSW	4	154984450	missense	probably damaging	0.99
R1717:Plch2	UTSW	4	154998272	missense	probably benign
R1731:Plch2	UTSW	4	155006994	missense	possibly damaging	0.83
R1875:Plch2	UTSW	4	154998508	missense	probably damaging	1.00
R1974:Plch2	UTSW	4	154984953	missense	possibly damaging	0.77
R2031:Plch2	UTSW	4	155043027	intron	probably benign
R2050:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R2061:Plch2	UTSW	4	155042841	intron	probably benign
R2073:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2075:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2109:Plch2	UTSW	4	154984597	missense	possibly damaging	0.92
R2126:Plch2	UTSW	4	154998999	missense	probably damaging	1.00
R2265:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2266:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2269:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2280:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2281:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2432:Plch2	UTSW	4	154986164	makesense	probably null
R2971:Plch2	UTSW	4	154990767	missense	probably benign	0.29
R3437:Plch2	UTSW	4	154991013	critical splice donor site	probably null
R3980:Plch2	UTSW	4	154984798	missense	probably benign	0.00
R4757:Plch2	UTSW	4	154996233	missense	possibly damaging	0.88
R4827:Plch2	UTSW	4	154991113	missense	probably damaging	1.00
R4828:Plch2	UTSW	4	154984635	missense	probably benign	0.01
R4869:Plch2	UTSW	4	154989428	missense	probably benign	0.28
R5020:Plch2	UTSW	4	155007083	missense	probably damaging	1.00
R5050:Plch2	UTSW	4	155043309	intron	probably benign
R5126:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R5237:Plch2	UTSW	4	155010794	missense	probably benign
R5274:Plch2	UTSW	4	154998954	missense	probably damaging	1.00
R5296:Plch2	UTSW	4	154989999	splice site	probably null
R5324:Plch2	UTSW	4	154984534	missense	probably benign
R5475:Plch2	UTSW	4	155000137	missense	probably damaging	1.00
R5494:Plch2	UTSW	4	154991122	missense	probably damaging	1.00
R5811:Plch2	UTSW	4	154992567	missense	possibly damaging	0.62
R6083:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R6092:Plch2	UTSW	4	154984372	missense	probably benign	0.02
R6253:Plch2	UTSW	4	155007101	missense	probably damaging	1.00
R6456:Plch2	UTSW	4	154993002	missense	probably damaging	1.00
R7038:Plch2	UTSW	4	154990032	splice site	probably null
R7084:Plch2	UTSW	4	154986991	missense	probably benign	0.31
R7210:Plch2	UTSW	4	155009086	missense	probably damaging	1.00
R7216:Plch2	UTSW	4	154984228	missense	probably benign
R7264:Plch2	UTSW	4	154998967	missense	probably damaging	0.98
R7291:Plch2	UTSW	4	154998472	missense	probably damaging	1.00
R7423:Plch2	UTSW	4	154983737	missense	probably damaging	1.00
R7436:Plch2	UTSW	4	154984096	missense	probably benign	0.01
R7438:Plch2	UTSW	4	155000460	missense	probably damaging	1.00
R7594:Plch2	UTSW	4	155007027	missense	probably damaging	1.00
R7663:Plch2	UTSW	4	154991162	missense	probably damaging	0.96
R7698:Plch2	UTSW	4	155002787	missense	possibly damaging	0.95
R7844:Plch2	UTSW	4	154989465	missense	probably damaging	1.00
R7939:Plch2	UTSW	4	155002778	missense	possibly damaging	0.91
R8003:Plch2	UTSW	4	155054523	missense	unknown
R8007:Plch2	UTSW	4	155002831	missense	probably damaging	1.00
R8281:Plch2	UTSW	4	155006973	missense	probably benign	0.07
R8434:Plch2	UTSW	4	154989735	missense	probably damaging	1.00
R8504:Plch2	UTSW	4	154984395	missense	probably benign	0.31
R8516:Plch2	UTSW	4	154986307	missense	probably benign
R8558:Plch2	UTSW	4	154998934	missense	probably damaging	1.00
R8722:Plch2	UTSW	4	154985403	unclassified	probably benign
R8768:Plch2	UTSW	4	154998867	missense	probably damaging	1.00
R8787:Plch2	UTSW	4	154986418	missense	probably benign	0.00
R8826:Plch2	UTSW	4	154986683	missense	probably benign	0.00
R8955:Plch2	UTSW	4	154992566	missense	probably benign	0.00
R9032:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9085:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9423:Plch2	UTSW	4	154986592	missense
R9649:Plch2	UTSW	4	154984059	missense	probably benign
R9652:Plch2	UTSW	4	154998485	missense	probably benign
R9725:Plch2	UTSW	4	155000535	missense	probably damaging	1.00
R9742:Plch2	UTSW	4	154998455	missense	probably damaging	0.99
R9789:Plch2	UTSW	4	155010865	critical splice donor site	probably null
RF014:Plch2	UTSW	4	155007120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGACTGAGATGAGAGATTGCCAC -3'
(R):5'- CACCACTGAGAGGTCAGACATTGC -3'

Sequencing Primer
(F):5'- ATAGTCACTTGACCATCCTGC -3'
(R):5'- AGGTCAGACATTGCCCCTC -3'

Posted On

2014-05-23