Incidental Mutation 'R0077:Rpap2'
ID19468
Institutional Source Beutler Lab
Gene Symbol Rpap2
Ensembl Gene ENSMUSG00000033773
Gene NameRNA polymerase II associated protein 2
Synonyms
MMRRC Submission 038364-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0077 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107597373-107661838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107620474 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 393 (S393P)
Ref Sequence ENSEMBL: ENSMUSP00000108274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065422] [ENSMUST00000112650] [ENSMUST00000112651] [ENSMUST00000112654] [ENSMUST00000112655]
Predicted Effect probably damaging
Transcript: ENSMUST00000065422
AA Change: S393P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070209
Gene: ENSMUSG00000033773
AA Change: S393P

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 80 152 3.6e-26 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112650
AA Change: S314P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108269
Gene: ENSMUSG00000033773
AA Change: S314P

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 1.7e-28 PFAM
low complexity region 129 142 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112651
AA Change: S316P

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108270
Gene: ENSMUSG00000033773
AA Change: S316P

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 76 1.9e-28 PFAM
low complexity region 131 144 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 482 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112654
AA Change: S393P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108273
Gene: ENSMUSG00000033773
AA Change: S393P

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 1.8e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112655
AA Change: S393P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108274
Gene: ENSMUSG00000033773
AA Change: S393P

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 4.1e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.5%
Validation Efficiency 83% (159/192)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,771,685 probably benign Het
Adgrl4 A G 3: 151,517,781 I624V probably damaging Het
AI661453 A G 17: 47,469,362 probably benign Het
Alg12 C T 15: 88,815,978 E60K probably damaging Het
Angel2 A T 1: 190,933,087 N72Y possibly damaging Het
Ank1 C A 8: 23,140,167 P81Q probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Bpi T A 2: 158,261,334 M83K probably damaging Het
Capn7 A G 14: 31,368,115 I642V probably benign Het
Ccdc134 T C 15: 82,131,737 probably benign Het
Ccr3 C T 9: 124,029,024 T132I probably damaging Het
Cfap65 C A 1: 74,931,918 W80C probably damaging Het
Chaf1a T A 17: 56,047,384 I218K unknown Het
Ddx23 A G 15: 98,656,600 probably null Het
Dmkn A G 7: 30,765,294 S231G probably benign Het
Ep300 T C 15: 81,641,313 I1446T unknown Het
Fmnl1 T C 11: 103,189,969 F318S probably damaging Het
Grik5 A T 7: 25,023,380 V497E probably damaging Het
Gtf2ird2 T C 5: 134,214,083 Y380H probably damaging Het
Hecw2 C T 1: 53,868,831 probably benign Het
Hspb7 A G 4: 141,424,047 I167V probably damaging Het
Kcnh2 T A 5: 24,322,702 N884I probably benign Het
Krba1 T C 6: 48,405,225 probably benign Het
Krt18 G T 15: 102,030,974 R294L probably benign Het
Lctl T A 9: 64,122,107 M1K probably null Het
Lingo2 G A 4: 35,708,375 S535F possibly damaging Het
Lrba A C 3: 86,542,688 N2105H probably damaging Het
Lrrc10 A G 10: 117,045,514 D31G probably damaging Het
Lrrtm1 T A 6: 77,243,872 V104E probably damaging Het
Mgat3 C T 15: 80,212,577 T535I probably benign Het
Nav3 T C 10: 109,716,642 I1780V possibly damaging Het
Nlrc4 A G 17: 74,446,831 W186R probably damaging Het
Nr2c1 T A 10: 94,188,255 F441I probably benign Het
Obscn A G 11: 59,051,521 probably benign Het
Olfr221 T C 14: 52,035,985 N42S possibly damaging Het
Olfr444 T C 6: 42,955,773 S92P probably benign Het
Olfr59 T C 11: 74,288,675 F10L probably benign Het
Olfr688 T C 7: 105,288,519 V142A probably damaging Het
Osr1 A T 12: 9,579,691 Y188F probably damaging Het
Pak2 A T 16: 32,033,843 N293K possibly damaging Het
Pappa A T 4: 65,307,812 T1301S probably damaging Het
Pde4dip G A 3: 97,753,126 Q679* probably null Het
Pik3r5 T A 11: 68,486,622 probably null Het
Plbd2 C T 5: 120,486,039 probably null Het
Ppp1r3a G T 6: 14,754,517 P244T possibly damaging Het
Pum1 C A 4: 130,772,674 R960S probably benign Het
Ralgapb T C 2: 158,473,249 Y845H probably damaging Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Rdh1 A T 10: 127,760,037 I34F probably damaging Het
Rgl3 T A 9: 21,974,102 Q644L probably benign Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
S100a11 A C 3: 93,524,202 probably null Het
Sept4 T C 11: 87,581,196 S11P probably benign Het
Serpina1c T C 12: 103,896,091 S322G probably benign Het
Setdb1 A T 3: 95,341,451 C385S probably damaging Het
Shank2 A T 7: 144,192,467 I193F possibly damaging Het
Slc4a11 G T 2: 130,686,301 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tbcd C A 11: 121,594,274 Q761K probably benign Het
Tmed6 C T 8: 107,065,566 V16M probably damaging Het
Tmem229a T C 6: 24,955,702 T18A probably benign Het
Tsc1 T A 2: 28,678,943 probably benign Het
Ube2m T C 7: 13,035,730 N49D probably damaging Het
Ubqlnl T C 7: 104,150,047 D81G probably damaging Het
Vmn2r56 A G 7: 12,715,405 V302A probably benign Het
Vmn2r73 T A 7: 85,875,867 R24S probably benign Het
Wfs1 C A 5: 36,973,194 S236I probably damaging Het
Xpot A T 10: 121,605,639 N560K probably benign Het
Yipf3 A G 17: 46,251,577 T303A probably benign Het
Zfp790 T C 7: 29,824,875 W19R probably damaging Het
Zfp846 T C 9: 20,594,007 C388R probably benign Het
Zpr1 T A 9: 46,273,336 I47N probably damaging Het
Other mutations in Rpap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rpap2 APN 5 107603631 unclassified probably benign
IGL01451:Rpap2 APN 5 107603626 critical splice donor site probably null
IGL01583:Rpap2 APN 5 107620195 missense probably damaging 0.99
IGL01837:Rpap2 APN 5 107625969 critical splice donor site probably null
IGL02343:Rpap2 APN 5 107618181 splice site probably null
IGL02999:Rpap2 APN 5 107601831 missense possibly damaging 0.61
IGL03261:Rpap2 APN 5 107598560 missense possibly damaging 0.95
IGL03381:Rpap2 APN 5 107620201 missense probably benign 0.00
R1698:Rpap2 UTSW 5 107603550 missense probably damaging 1.00
R1897:Rpap2 UTSW 5 107633095 missense possibly damaging 0.85
R3039:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R3605:Rpap2 UTSW 5 107620529 missense probably damaging 1.00
R3735:Rpap2 UTSW 5 107655151 splice site probably benign
R4007:Rpap2 UTSW 5 107603872 missense probably damaging 1.00
R4367:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4448:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4589:Rpap2 UTSW 5 107620495 missense probably benign 0.00
R4606:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4799:Rpap2 UTSW 5 107620247 missense probably benign 0.00
R4939:Rpap2 UTSW 5 107603625 critical splice donor site probably null
R5580:Rpap2 UTSW 5 107620145 missense probably benign 0.12
R6003:Rpap2 UTSW 5 107601901 unclassified probably null
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6142:Rpap2 UTSW 5 107598298 missense probably benign
R6161:Rpap2 UTSW 5 107620670 missense probably damaging 1.00
R6687:Rpap2 UTSW 5 107603630 splice site probably null
R6761:Rpap2 UTSW 5 107620238 missense probably benign
R6783:Rpap2 UTSW 5 107655287 missense probably damaging 0.99
R7106:Rpap2 UTSW 5 107633122 nonsense probably null
R7314:Rpap2 UTSW 5 107620379 missense probably damaging 0.96
R7402:Rpap2 UTSW 5 107620458 nonsense probably null
R7644:Rpap2 UTSW 5 107620301 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCTTCCAGCTCTTGGAGTGAGCG -3'
(R):5'- TGTCTGAGCCTCTAAAGGGCAGTG -3'

Sequencing Primer
(F):5'- CACGGTGTATCACAAGTTACG -3'
(R):5'- CACAACTACCTGGGTCACAA -3'
Posted On2013-04-11