Incidental Mutation 'R1769:Nup205'
ID194685
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Namenucleoporin 205
Synonyms3830404O05Rik
MMRRC Submission 039800-MU
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location35177421-35247596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35205431 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 777 (G777D)
Ref Sequence ENSEMBL: ENSMUSP00000144126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
Predicted Effect probably damaging
Transcript: ENSMUST00000043815
AA Change: G724D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: G724D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201374
AA Change: G777D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: G777D

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202898
Meta Mutation Damage Score 0.8228 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0543:Nup205 UTSW 6 35198969 missense probably benign
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1033:Nup205 UTSW 6 35227442 missense probably benign
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1839:Nup205 UTSW 6 35219714 missense probably benign 0.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.34
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5251:Nup205 UTSW 6 35196482 intron probably null
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5760:Nup205 UTSW 6 35247343 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7428:Nup205 UTSW 6 35227559 missense probably damaging 1.00
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
R7841:Nup205 UTSW 6 35247437 missense unknown
R7924:Nup205 UTSW 6 35247437 missense unknown
R8073:Nup205 UTSW 6 35202169 critical splice donor site unknown
Z1177:Nup205 UTSW 6 35177605 missense not run
Z1177:Nup205 UTSW 6 35208793 critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- ACTGGCAACATGCTTTACCTCTGC -3'
(R):5'- AGCATCCCATTGTTCCCAACAAAGG -3'

Sequencing Primer
(F):5'- ATGCTTTACCTCTGCTTAGTAGTTTG -3'
(R):5'- CTGCTCAATTAGACATGGCG -3'
Posted On2014-05-23