Incidental Mutation 'R1769:Slc1a5'
Institutional Source Beutler Lab
Gene Symbol Slc1a5
Ensembl Gene ENSMUSG00000001918
Gene Namesolute carrier family 1 (neutral amino acid transporter), member 5
MMRRC Submission 039800-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosomal Location16781340-16798274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16797539 bp
Amino Acid Change Alanine to Serine at position 490 (A490S)
Ref Sequence ENSEMBL: ENSMUSP00000104136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108496]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000108496
AA Change: A490S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104136
Gene: ENSMUSG00000001918
AA Change: A490S

Pfam:SDF 55 499 1.5e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135817
SMART Domains Protein: ENSMUSP00000116654
Gene: ENSMUSG00000001918

Pfam:SDF 3 139 7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147814
Meta Mutation Damage Score 0.4190 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cells, CD4+ memory T cells in older mice, Th1 and Th17 T cells, susceptibility to EAE and T cell uptake of glutamine and leucine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Slc1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Slc1a5 APN 7 16786879 nonsense probably null
IGL01295:Slc1a5 APN 7 16795862 missense probably damaging 1.00
IGL02388:Slc1a5 APN 7 16785719 critical splice donor site probably null
IGL02863:Slc1a5 APN 7 16793721 missense probably benign
IGL03149:Slc1a5 APN 7 16789820 missense probably damaging 0.96
R0001:Slc1a5 UTSW 7 16793637 splice site probably null
R0368:Slc1a5 UTSW 7 16782178 missense probably damaging 1.00
R0690:Slc1a5 UTSW 7 16786904 missense probably benign
R1430:Slc1a5 UTSW 7 16782403 missense probably benign 0.00
R4058:Slc1a5 UTSW 7 16795853 missense probably damaging 0.98
R4944:Slc1a5 UTSW 7 16797743 utr 3 prime probably benign
R5220:Slc1a5 UTSW 7 16793834 missense probably damaging 1.00
R5976:Slc1a5 UTSW 7 16795882 missense probably damaging 1.00
R5986:Slc1a5 UTSW 7 16782226 missense probably benign 0.26
R7171:Slc1a5 UTSW 7 16797538 missense probably damaging 1.00
R7270:Slc1a5 UTSW 7 16785698 missense probably damaging 1.00
R7345:Slc1a5 UTSW 7 16796160 critical splice donor site probably null
R7630:Slc1a5 UTSW 7 16795807 missense probably damaging 1.00
R7920:Slc1a5 UTSW 7 16793870 missense probably damaging 1.00
R7944:Slc1a5 UTSW 7 16789882 missense possibly damaging 0.50
R7945:Slc1a5 UTSW 7 16789882 missense possibly damaging 0.50
R8221:Slc1a5 UTSW 7 16781977 missense probably benign 0.05
Z1088:Slc1a5 UTSW 7 16797669 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acaatggggaggtagcaaag -3'
Posted On2014-05-23