Incidental Mutation 'R1769:Olfr855'
ID194700
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Nameolfactory receptor 855
SynonymsMOR148-1, GA_x6K02T2PVTD-13330461-13331399
MMRRC Submission 039800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19582617-19586030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19585386 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 283 (Q283L)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
AlphaFold Q7TRF8
Predicted Effect probably damaging
Transcript: ENSMUST00000061693
AA Change: Q283L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: Q283L

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215587
AA Change: Q283L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.2047 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R3117:Olfr855 UTSW 9 19584941 missense probably damaging 0.99
R4002:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8112:Olfr855 UTSW 9 19584724 missense probably benign 0.44
R8470:Olfr855 UTSW 9 19584969 missense probably damaging 0.99
R9155:Olfr855 UTSW 9 19585083 missense not run
Predicted Primers PCR Primer
(F):5'- GGTCATCAAGCTTTCCTGTTCTGACAC -3'
(R):5'- CACAGATGTTGACGCATAGAGAGTCC -3'

Sequencing Primer
(F):5'- GTTCTGACACCCGAATTGAC -3'
(R):5'- CGCATAGAGAGTCCAAGATTCAG -3'
Posted On2014-05-23