Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Exph5'

194703

Institutional Source

Beutler Lab

Gene Symbol

Exph5

Ensembl Gene

ENSMUSG00000034584

Gene Name

exophilin 5

Synonyms

Slac2b, AC079869.22gm5, B130009M24Rik, slac2-b

MMRRC Submission

039800-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1769 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53301670-53377514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53373809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 730 (N730S)

Ref Sequence

ENSEMBL: ENSMUSP00000062632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051014]

AlphaFold

Q0VAV2

Predicted Effect

probably benign
Transcript: ENSMUST00000051014
AA Change: N730S

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: N730S

Domain	Start	End	E-Value	Type
low complexity region	112	131	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
low complexity region	673	682	N/A	INTRINSIC
low complexity region	970	980	N/A	INTRINSIC
low complexity region	1556	1568	N/A	INTRINSIC
low complexity region	1747	1757	N/A	INTRINSIC
low complexity region	1937	1959	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132410

Meta Mutation Damage Score

0.0773

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Exph5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Exph5	APN	9	53376706	nonsense	probably null
IGL01387:Exph5	APN	9	53373965	missense	possibly damaging	0.95
IGL01985:Exph5	APN	9	53376569	missense	probably damaging	0.99
IGL02122:Exph5	APN	9	53373674	missense	probably benign	0.05
IGL02156:Exph5	APN	9	53375641	missense	probably damaging	0.96
IGL02192:Exph5	APN	9	53376325	nonsense	probably null
IGL02491:Exph5	APN	9	53375043	missense	possibly damaging	0.89
PIT4802001:Exph5	UTSW	9	53374978	missense	probably damaging	0.96
R0002:Exph5	UTSW	9	53373956	missense	probably damaging	0.99
R0026:Exph5	UTSW	9	53376479	missense	probably benign	0.38
R0086:Exph5	UTSW	9	53337930	missense	possibly damaging	0.90
R0152:Exph5	UTSW	9	53353204	critical splice donor site	probably null
R0369:Exph5	UTSW	9	53373302	missense	probably benign	0.35
R0409:Exph5	UTSW	9	53374343	missense	probably benign	0.00
R0517:Exph5	UTSW	9	53372762	missense	probably benign	0.02
R0658:Exph5	UTSW	9	53377475	missense	unknown
R1606:Exph5	UTSW	9	53374295	missense	probably benign	0.37
R1739:Exph5	UTSW	9	53375588	missense	possibly damaging	0.62
R1828:Exph5	UTSW	9	53376641	missense	possibly damaging	0.79
R1862:Exph5	UTSW	9	53376248	missense	probably benign
R1993:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R2012:Exph5	UTSW	9	53367166	missense	possibly damaging	0.49
R2044:Exph5	UTSW	9	53372679	missense	possibly damaging	0.79
R2402:Exph5	UTSW	9	53374925	nonsense	probably null
R3817:Exph5	UTSW	9	53375494	nonsense	probably null
R4771:Exph5	UTSW	9	53373665	missense	possibly damaging	0.95
R4869:Exph5	UTSW	9	53376239	missense	possibly damaging	0.73
R4926:Exph5	UTSW	9	53376625	missense	possibly damaging	0.95
R4996:Exph5	UTSW	9	53375610	missense	possibly damaging	0.79
R5254:Exph5	UTSW	9	53337930	missense	probably damaging	0.99
R5522:Exph5	UTSW	9	53374313	missense	possibly damaging	0.90
R5947:Exph5	UTSW	9	53375222	missense	probably benign	0.04
R5961:Exph5	UTSW	9	53377255	missense	probably damaging	1.00
R6093:Exph5	UTSW	9	53372617	missense	possibly damaging	0.94
R6144:Exph5	UTSW	9	53373028	missense	probably benign	0.21
R6254:Exph5	UTSW	9	53372710	missense	possibly damaging	0.81
R6279:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6300:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6485:Exph5	UTSW	9	53376691	missense	possibly damaging	0.89
R6553:Exph5	UTSW	9	53301712	start gained	probably benign
R6792:Exph5	UTSW	9	53375317	missense	possibly damaging	0.52
R7026:Exph5	UTSW	9	53340428	missense	probably benign	0.27
R7340:Exph5	UTSW	9	53377009	missense	probably damaging	0.99
R7347:Exph5	UTSW	9	53375896	missense	possibly damaging	0.79
R7352:Exph5	UTSW	9	53375722	missense	probably benign	0.00
R7520:Exph5	UTSW	9	53367214	critical splice donor site	probably null
R7521:Exph5	UTSW	9	53374077	missense	possibly damaging	0.89
R7560:Exph5	UTSW	9	53375773	missense	probably benign	0.41
R7581:Exph5	UTSW	9	53372557	missense	possibly damaging	0.90
R7726:Exph5	UTSW	9	53373175	missense	possibly damaging	0.62
R7976:Exph5	UTSW	9	53376635	missense	possibly damaging	0.79
R8017:Exph5	UTSW	9	53373452	missense	probably benign
R8019:Exph5	UTSW	9	53373452	missense	probably benign
R8302:Exph5	UTSW	9	53376476	missense	possibly damaging	0.89
R8420:Exph5	UTSW	9	53375848	nonsense	probably null
R8551:Exph5	UTSW	9	53374051	missense	possibly damaging	0.94
R8708:Exph5	UTSW	9	53375796	missense	probably benign
R8889:Exph5	UTSW	9	53376655	missense	probably damaging	1.00
R9048:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R9255:Exph5	UTSW	9	53373309	missense	possibly damaging	0.79
R9727:Exph5	UTSW	9	53376402	missense	probably damaging	0.96
X0028:Exph5	UTSW	9	53376263	missense	probably damaging	1.00
Z1177:Exph5	UTSW	9	53374213	missense	probably benign	0.44
Z1177:Exph5	UTSW	9	53377419	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGCCTGTAGCCATTCTACTGAC -3'
(R):5'- ACAACCTTGATTTGGGCTGGGAAG -3'

Sequencing Primer
(F):5'- GTAGCCATTCTACTGACTCACTG -3'
(R):5'- AAGAGATGTCGCTGTTCCAC -3'

Posted On

2014-05-23