Incidental Mutation 'R1769:Ptpn23'
ID 194706
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Name protein tyrosine phosphatase, non-receptor type 23
Synonyms PTP-TD14
MMRRC Submission 039800-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1769 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 110214152-110237278 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110220746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 255 (H255Y)
Ref Sequence ENSEMBL: ENSMUSP00000039580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021]
AlphaFold Q6PB44
PDB Structure MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040021
AA Change: H255Y

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: H255Y

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199254
Meta Mutation Damage Score 0.3366 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik A G 5: 138,644,519 (GRCm39) I135V probably benign Het
Abca1 T A 4: 53,074,325 (GRCm39) K1119N probably damaging Het
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Abcc9 T C 6: 142,573,194 (GRCm39) probably benign Het
Akap3 A G 6: 126,842,809 (GRCm39) E476G possibly damaging Het
Aldh3b1 A G 19: 3,968,740 (GRCm39) F271S probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ascc3 T C 10: 50,576,586 (GRCm39) V847A probably damaging Het
Best3 A G 10: 116,859,883 (GRCm39) N381S probably benign Het
Blm A T 7: 80,163,118 (GRCm39) S78T probably benign Het
Bmpr2 T A 1: 59,907,520 (GRCm39) L871Q probably damaging Het
Car13 T A 3: 14,715,795 (GRCm39) H104Q probably benign Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Ccnb1ip1 T C 14: 51,029,568 (GRCm39) M165V probably benign Het
Cd4 A T 6: 124,843,618 (GRCm39) M431K possibly damaging Het
Cdh20 C T 1: 109,980,606 (GRCm39) T178I probably damaging Het
Ceacam3 C T 7: 16,892,301 (GRCm39) T348I probably damaging Het
Cfap54 C T 10: 92,740,125 (GRCm39) probably null Het
Clcn6 A T 4: 148,098,758 (GRCm39) probably null Het
Csf3 A G 11: 98,593,246 (GRCm39) Y121C probably damaging Het
Csmd3 C T 15: 47,567,505 (GRCm39) probably benign Het
Cyp2c69 A G 19: 39,864,815 (GRCm39) I221T probably benign Het
Dgcr2 T C 16: 17,675,115 (GRCm39) probably benign Het
Dhcr7 T C 7: 143,401,250 (GRCm39) F474S probably damaging Het
Dnah1 T C 14: 31,032,839 (GRCm39) I399V probably null Het
Efcab14 T A 4: 115,610,188 (GRCm39) L183Q probably damaging Het
Evx2 A G 2: 74,489,501 (GRCm39) V88A probably benign Het
Exph5 A G 9: 53,285,109 (GRCm39) N730S probably benign Het
Farsb T A 1: 78,443,620 (GRCm39) K196I probably benign Het
Fbln7 C T 2: 128,735,682 (GRCm39) probably benign Het
Fhdc1 A G 3: 84,356,085 (GRCm39) F453S probably damaging Het
Gast T A 11: 100,227,684 (GRCm39) W89R probably damaging Het
Gata2 A G 6: 88,182,237 (GRCm39) S402G probably benign Het
Gin1 T A 1: 97,720,162 (GRCm39) S386T probably benign Het
Golgb1 A G 16: 36,736,363 (GRCm39) E1870G probably damaging Het
Hivep3 T A 4: 119,954,768 (GRCm39) V1028E possibly damaging Het
Ifi203 G A 1: 173,756,326 (GRCm39) R486* probably null Het
Ifi209 G A 1: 173,468,728 (GRCm39) S186N probably benign Het
Ifih1 C T 2: 62,436,738 (GRCm39) A562T probably damaging Het
Itch T C 2: 155,014,481 (GRCm39) L106S probably damaging Het
Itga4 T A 2: 79,146,050 (GRCm39) probably null Het
Kdm4c A G 4: 74,199,234 (GRCm39) S141G possibly damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klra3 T C 6: 130,307,226 (GRCm39) probably null Het
Lama2 A T 10: 27,084,402 (GRCm39) S923T probably damaging Het
Lama2 G C 10: 27,084,403 (GRCm39) F922L probably benign Het
Llgl1 G A 11: 60,597,873 (GRCm39) V331M probably damaging Het
Lrrc30 T C 17: 67,938,676 (GRCm39) *301W probably null Het
Map1lc3b C T 8: 122,320,226 (GRCm39) probably benign Het
Mbd2 A G 18: 70,749,690 (GRCm39) I302V probably benign Het
Med27 A G 2: 29,390,307 (GRCm39) Y78C probably damaging Het
Mei1 C T 15: 81,996,771 (GRCm39) probably null Het
Mideas G A 12: 84,205,124 (GRCm39) probably benign Het
Miga1 T C 3: 151,993,191 (GRCm39) E346G probably damaging Het
Myef2 A G 2: 124,957,363 (GRCm39) S131P probably damaging Het
Myocd T C 11: 65,069,527 (GRCm39) H899R probably benign Het
Ncam1 A G 9: 49,456,556 (GRCm39) probably benign Het
Ngf T A 3: 102,427,513 (GRCm39) N87K possibly damaging Het
Nol10 T A 12: 17,466,709 (GRCm39) probably benign Het
Nrip2 A G 6: 128,385,231 (GRCm39) I221V probably benign Het
Nup205 G A 6: 35,182,366 (GRCm39) G777D probably damaging Het
Or5ac17 A G 16: 59,036,344 (GRCm39) F211L probably benign Het
Or5b96 A G 19: 12,867,047 (GRCm39) V298A probably damaging Het
Or6c1 T A 10: 129,518,081 (GRCm39) T176S probably benign Het
Or7g35 A T 9: 19,496,682 (GRCm39) Q283L probably damaging Het
Or8d6 G T 9: 39,854,251 (GRCm39) D232Y probably benign Het
Oxt A T 2: 130,418,220 (GRCm39) R31W probably damaging Het
Pde4dip A G 3: 97,603,246 (GRCm39) S2248P probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pkp2 T C 16: 16,080,561 (GRCm39) S616P probably damaging Het
Plch2 T C 4: 155,084,540 (GRCm39) Y379C probably damaging Het
Pnpt1 A G 11: 29,104,159 (GRCm39) N540D probably benign Het
Rad21 T C 15: 51,835,703 (GRCm39) N237D probably benign Het
Ryr3 A C 2: 112,582,113 (GRCm39) probably null Het
Sgk1 C A 10: 21,873,007 (GRCm39) probably benign Het
Slc1a5 G T 7: 16,531,464 (GRCm39) A490S probably damaging Het
Slc5a8 T C 10: 88,755,326 (GRCm39) Y478H probably benign Het
Slc5a8 T A 10: 88,755,328 (GRCm39) Y478* probably null Het
Slc9a3 A T 13: 74,311,190 (GRCm39) M562L probably benign Het
Spmip4 A G 6: 50,568,801 (GRCm39) probably benign Het
Thsd7a G A 6: 12,555,714 (GRCm39) R57* probably null Het
Tiam1 T C 16: 89,657,167 (GRCm39) R690G probably damaging Het
Tmem150b A G 7: 4,727,365 (GRCm39) S47P probably damaging Het
Trim39 C T 17: 36,574,832 (GRCm39) R190Q probably damaging Het
Ttc32 A T 12: 9,085,073 (GRCm39) I98L possibly damaging Het
Vps13c A G 9: 67,873,003 (GRCm39) T3304A probably benign Het
Wdr35 A C 12: 9,062,728 (GRCm39) D638A probably damaging Het
Wwc1 G T 11: 35,752,671 (GRCm39) P797T probably benign Het
Zan T A 5: 137,462,780 (GRCm39) T800S unknown Het
Zbbx A G 3: 74,990,926 (GRCm39) probably benign Het
Zup1 T C 10: 33,811,172 (GRCm39) M291V probably damaging Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110,217,174 (GRCm39) missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110,237,175 (GRCm39) missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110,215,613 (GRCm39) missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110,220,704 (GRCm39) missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110,222,781 (GRCm39) missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110,217,088 (GRCm39) nonsense probably null
peony UTSW 9 110,215,575 (GRCm39) missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110,214,691 (GRCm39) missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110,217,200 (GRCm39) missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110,218,078 (GRCm39) critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110,218,861 (GRCm39) splice site probably null
R0457:Ptpn23 UTSW 9 110,215,361 (GRCm39) missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110,217,845 (GRCm39) missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110,215,663 (GRCm39) missense probably benign 0.29
R1859:Ptpn23 UTSW 9 110,217,938 (GRCm39) missense possibly damaging 0.92
R1891:Ptpn23 UTSW 9 110,222,868 (GRCm39) missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110,215,575 (GRCm39) missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110,215,393 (GRCm39) missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110,221,581 (GRCm39) missense possibly damaging 0.72
R2431:Ptpn23 UTSW 9 110,215,347 (GRCm39) nonsense probably null
R2445:Ptpn23 UTSW 9 110,216,700 (GRCm39) missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110,218,763 (GRCm39) missense probably benign
R3820:Ptpn23 UTSW 9 110,218,862 (GRCm39) unclassified probably benign
R3904:Ptpn23 UTSW 9 110,218,313 (GRCm39) missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110,221,793 (GRCm39) missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110,215,881 (GRCm39) missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110,217,924 (GRCm39) missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110,218,204 (GRCm39) missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110,221,806 (GRCm39) missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110,217,624 (GRCm39) missense probably benign 0.00
R5057:Ptpn23 UTSW 9 110,217,624 (GRCm39) missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110,227,256 (GRCm39) missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110,214,506 (GRCm39) unclassified probably benign
R5370:Ptpn23 UTSW 9 110,214,769 (GRCm39) missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110,221,809 (GRCm39) missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110,216,143 (GRCm39) missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110,214,511 (GRCm39) unclassified probably benign
R6122:Ptpn23 UTSW 9 110,216,893 (GRCm39) unclassified probably benign
R6155:Ptpn23 UTSW 9 110,216,849 (GRCm39) unclassified probably benign
R6156:Ptpn23 UTSW 9 110,216,849 (GRCm39) unclassified probably benign
R6296:Ptpn23 UTSW 9 110,222,894 (GRCm39) missense probably damaging 0.96
R6755:Ptpn23 UTSW 9 110,218,855 (GRCm39) missense probably damaging 0.98
R7018:Ptpn23 UTSW 9 110,214,884 (GRCm39) missense possibly damaging 0.89
R7126:Ptpn23 UTSW 9 110,217,812 (GRCm39) missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110,214,325 (GRCm39) missense unknown
R7578:Ptpn23 UTSW 9 110,216,676 (GRCm39) missense probably benign 0.33
R7675:Ptpn23 UTSW 9 110,216,094 (GRCm39) nonsense probably null
R7776:Ptpn23 UTSW 9 110,215,368 (GRCm39) missense possibly damaging 0.89
R7797:Ptpn23 UTSW 9 110,222,875 (GRCm39) missense possibly damaging 0.86
R8071:Ptpn23 UTSW 9 110,217,268 (GRCm39) missense possibly damaging 0.93
R8071:Ptpn23 UTSW 9 110,217,267 (GRCm39) missense probably damaging 0.98
R8954:Ptpn23 UTSW 9 110,221,568 (GRCm39) missense probably damaging 1.00
R9063:Ptpn23 UTSW 9 110,218,693 (GRCm39) missense possibly damaging 0.85
R9208:Ptpn23 UTSW 9 110,237,101 (GRCm39) critical splice donor site probably null
R9380:Ptpn23 UTSW 9 110,221,581 (GRCm39) missense possibly damaging 0.72
R9404:Ptpn23 UTSW 9 110,216,025 (GRCm39) missense
R9570:Ptpn23 UTSW 9 110,227,217 (GRCm39) missense probably damaging 0.96
R9649:Ptpn23 UTSW 9 110,215,226 (GRCm39) critical splice acceptor site probably null
X0062:Ptpn23 UTSW 9 110,216,775 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTACAAACAAGGGCTGCAAGGTG -3'
(R):5'- GTCCATGTTGGACAACCGGAAGAG -3'

Sequencing Primer
(F):5'- CTGCAAGGTGGTGATGGC -3'
(R):5'- GCCTTGGAAAACCCTGATACTG -3'
Posted On 2014-05-23