Incidental Mutation 'R1769:Sgk1'
ID194707
Institutional Source Beutler Lab
Gene Symbol Sgk1
Ensembl Gene ENSMUSG00000019970
Gene Nameserum/glucocorticoid regulated kinase 1
SynonymsSgk, Sgk1
MMRRC Submission 039800-MU
Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location21882184-21999903 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 21997108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000150089] [ENSMUST00000164659]
Predicted Effect probably benign
Transcript: ENSMUST00000020145
SMART Domains Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 36 72 4e-10 BLAST
low complexity region 73 80 N/A INTRINSIC
S_TKc 98 355 6.15e-106 SMART
S_TK_X 356 425 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092673
SMART Domains Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Blast:S_TKc 50 86 5e-10 BLAST
low complexity region 87 94 N/A INTRINSIC
S_TKc 112 369 6.15e-106 SMART
S_TK_X 370 439 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100036
SMART Domains Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 5e-10 BLAST
low complexity region 59 66 N/A INTRINSIC
S_TKc 84 341 6.15e-106 SMART
S_TK_X 342 411 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120509
SMART Domains Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 129 165 1e-9 BLAST
low complexity region 166 173 N/A INTRINSIC
S_TKc 191 448 6.15e-106 SMART
S_TK_X 449 518 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124350
SMART Domains Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 2e-12 BLAST
low complexity region 46 53 N/A INTRINSIC
Pfam:Pkinase 71 266 3.2e-62 PFAM
Pfam:Pkinase_Tyr 71 266 4.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141218
Predicted Effect probably benign
Transcript: ENSMUST00000142174
SMART Domains Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 3e-14 BLAST
PDB:3HDN|A 33 82 7e-18 PDB
SCOP:d1koba_ 43 82 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150089
SMART Domains Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 4e-14 BLAST
PDB:3HDN|A 46 89 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164659
SMART Domains Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 5e-10 BLAST
low complexity region 46 53 N/A INTRINSIC
S_TKc 71 328 6.15e-106 SMART
S_TK_X 329 398 2.51e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Llgl1 G A 11: 60,707,047 V331M probably damaging Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Sgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Sgk1 APN 10 21995541 missense probably damaging 1.00
IGL02670:Sgk1 APN 10 21928546 missense probably benign
IGL03220:Sgk1 APN 10 21997391 missense probably null 1.00
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0467:Sgk1 UTSW 10 21996358 splice site probably benign
R0479:Sgk1 UTSW 10 21996310 missense probably benign 0.00
R0650:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0652:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0688:Sgk1 UTSW 10 21998160 missense probably benign
R0990:Sgk1 UTSW 10 21997086 missense probably damaging 1.00
R2009:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2218:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2314:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2909:Sgk1 UTSW 10 21994816 missense probably benign
R2915:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3176:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3177:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3276:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3277:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3802:Sgk1 UTSW 10 21997412 missense probably damaging 1.00
R5974:Sgk1 UTSW 10 21996249 missense probably damaging 1.00
R6943:Sgk1 UTSW 10 21882694 missense probably damaging 0.99
R7360:Sgk1 UTSW 10 21994073 missense probably benign 0.01
R7425:Sgk1 UTSW 10 21994110 missense probably damaging 0.97
R7665:Sgk1 UTSW 10 21996662 missense probably damaging 1.00
R7973:Sgk1 UTSW 10 21994155 missense probably benign 0.01
R8252:Sgk1 UTSW 10 21997399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCATAATCCTAACAGCCCAAC -3'
(R):5'- TGCTTTGAAAAGAGCCAGGGTCAAC -3'

Sequencing Primer
(F):5'- GGGTTTGTCATGAAGTCAAGCTAAC -3'
(R):5'- CAGGGTCAACTGGCTCC -3'
Posted On2014-05-23