Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Lama2'

194708

Institutional Source

Beutler Lab

Gene Symbol

Lama2

Ensembl Gene

ENSMUSG00000019899

Gene Name

laminin, alpha 2

Synonyms

merosin, mer

MMRRC Submission

039800-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R1769 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26980036-27619758 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27208406 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 923 (S923T)

Ref Sequence

ENSEMBL: ENSMUSP00000140716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000092639
AA Change: S923T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: S923T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	29	281	5.35e-129	SMART
EGF_Lam	283	337	2.11e-4	SMART
EGF_Lam	340	407	1.59e-8	SMART
EGF_Lam	410	462	5.44e-7	SMART
EGF_Lam	465	511	9.05e-4	SMART
LamB	574	706	2.26e-44	SMART
Pfam:Laminin_EGF	715	745	2.8e-4	PFAM
EGF_Lam	753	800	4.03e-10	SMART
EGF_Lam	803	858	3.01e-9	SMART
EGF_Lam	861	911	1.35e-11	SMART
EGF_Lam	914	960	7.23e-12	SMART
EGF_Lam	963	1007	5.87e-12	SMART
EGF_Lam	1010	1053	1.28e-12	SMART
EGF_Lam	1056	1099	2.37e-7	SMART
EGF_Lam	1102	1159	3.22e-9	SMART
LamB	1225	1360	1.95e-57	SMART
EGF_like	1364	1413	8.13e-1	SMART
EGF_Lam	1416	1462	5.48e-12	SMART
EGF_Lam	1465	1520	1.27e-7	SMART
EGF_Lam	1523	1567	2.4e-8	SMART
Pfam:Laminin_I	1584	1849	2e-92	PFAM
Blast:MA	1881	2113	1e-112	BLAST
LamG	2162	2307	1.28e-25	SMART
LamG	2356	2500	2.2e-33	SMART
LamG	2542	2688	3.31e-28	SMART
low complexity region	2725	2741	N/A	INTRINSIC
LamG	2781	2914	2.25e-39	SMART
LamG	2956	3092	1.53e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189575
AA Change: S923T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: S923T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	29	281	2.5e-131	SMART
EGF_Lam	283	337	1e-6	SMART
EGF_Lam	340	407	7.7e-11	SMART
EGF_Lam	410	462	2.6e-9	SMART
EGF_Lam	465	511	4.5e-6	SMART
LamB	574	706	1.4e-46	SMART
Pfam:Laminin_EGF	715	745	1.7e-2	PFAM
EGF_Lam	753	800	1.9e-12	SMART
EGF_Lam	803	858	1.4e-11	SMART
EGF_Lam	861	911	6.7e-14	SMART
EGF_Lam	914	960	3.6e-14	SMART
EGF_Lam	963	1007	2.9e-14	SMART
EGF_Lam	1010	1053	6.1e-15	SMART
EGF_Lam	1056	1099	1.1e-9	SMART
EGF_Lam	1102	1159	1.5e-11	SMART
LamB	1225	1349	1.4e-45	SMART

Meta Mutation Damage Score

0.1687

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc5a8	T	C	10: 88,919,464	Y478H	probably benign	Het
Slc5a8	T	A	10: 88,919,466	Y478*	probably null	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Lama2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Lama2	APN	10	27188265	missense	probably benign	0.01
IGL00467:Lama2	APN	10	27467197	splice site	probably benign
IGL00470:Lama2	APN	10	27243742	missense	probably benign	0.22
IGL00517:Lama2	APN	10	27197330	missense	probably benign	0.01
IGL00541:Lama2	APN	10	27188306	missense	probably benign	0.14
IGL00931:Lama2	APN	10	27006776	missense	possibly damaging	0.92
IGL00951:Lama2	APN	10	27030285	missense	probably benign	0.03
IGL00988:Lama2	APN	10	27369015	nonsense	probably null
IGL01098:Lama2	APN	10	27031112	missense	possibly damaging	0.66
IGL01152:Lama2	APN	10	27208429	missense	probably benign	0.00
IGL01293:Lama2	APN	10	27231636	missense	probably benign	0.38
IGL01338:Lama2	APN	10	27188272	missense	probably benign	0.13
IGL01609:Lama2	APN	10	27344421	missense	probably benign	0.03
IGL01643:Lama2	APN	10	27070372	splice site	probably benign
IGL01675:Lama2	APN	10	27188054	missense	possibly damaging	0.77
IGL01681:Lama2	APN	10	27265045	missense	probably benign	0.33
IGL01694:Lama2	APN	10	27006742	missense	possibly damaging	0.75
IGL01705:Lama2	APN	10	27189274	splice site	probably benign
IGL01885:Lama2	APN	10	27105139	nonsense	probably null
IGL01935:Lama2	APN	10	27422604	missense	probably damaging	0.98
IGL01994:Lama2	APN	10	27467203	critical splice donor site	probably null
IGL02041:Lama2	APN	10	26984326	missense	probably damaging	1.00
IGL02067:Lama2	APN	10	27176796	missense	probably benign	0.02
IGL02097:Lama2	APN	10	27138960	missense	probably benign	0.09
IGL02179:Lama2	APN	10	27070364	missense	probably benign	0.01
IGL02268:Lama2	APN	10	27001116	splice site	probably benign
IGL02302:Lama2	APN	10	27212043	missense	probably benign	0.06
IGL02363:Lama2	APN	10	27366066	missense	probably damaging	1.00
IGL02378:Lama2	APN	10	27043656	missense	probably damaging	0.99
IGL02642:Lama2	APN	10	27467273	missense	probably damaging	1.00
IGL02676:Lama2	APN	10	27118493	missense	probably benign	0.00
IGL02695:Lama2	APN	10	27000775	missense	probably benign
IGL02735:Lama2	APN	10	27104128	missense	probably damaging	1.00
IGL02794:Lama2	APN	10	27041231	missense	possibly damaging	0.73
IGL02823:Lama2	APN	10	27001145	missense	probably damaging	1.00
IGL02869:Lama2	APN	10	27015538	missense	probably damaging	0.99
IGL02942:Lama2	APN	10	27041220	missense	probably damaging	1.00
IGL03201:Lama2	APN	10	27344570	nonsense	probably null
IGL03268:Lama2	APN	10	27422653	missense	probably damaging	1.00
IGL03288:Lama2	APN	10	27369051	missense	probably damaging	1.00
IGL03380:Lama2	APN	10	27050265	missense	probably damaging	1.00
IGL03407:Lama2	APN	10	27347021	missense	probably damaging	1.00
cowboy	UTSW	10	27043643	frame shift	probably null
petri	UTSW	10	26993398	splice site	probably null
PIT4362001:Lama2	UTSW	10	27369136	missense	probably damaging	1.00
PIT4382001:Lama2	UTSW	10	27204905	missense	probably damaging	1.00
PIT4431001:Lama2	UTSW	10	27101430	missense	probably damaging	1.00
R0038:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R0038:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R0114:Lama2	UTSW	10	26993068	nonsense	probably null
R0142:Lama2	UTSW	10	27187845	missense	probably benign
R0313:Lama2	UTSW	10	26993398	splice site	probably null
R0376:Lama2	UTSW	10	27015546	missense	possibly damaging	0.68
R0412:Lama2	UTSW	10	27190625	missense	possibly damaging	0.58
R0472:Lama2	UTSW	10	26990867	missense	probably damaging	1.00
R0607:Lama2	UTSW	10	27189131	missense	probably benign	0.34
R0648:Lama2	UTSW	10	26989376	missense	probably benign	0.00
R0667:Lama2	UTSW	10	27344410	splice site	probably null
R0760:Lama2	UTSW	10	27044433	critical splice donor site	probably null
R1240:Lama2	UTSW	10	27041124	missense	probably damaging	1.00
R1385:Lama2	UTSW	10	27224043	missense	probably benign	0.11
R1433:Lama2	UTSW	10	27187754	missense	probably damaging	1.00
R1434:Lama2	UTSW	10	27208370	missense	probably damaging	1.00
R1574:Lama2	UTSW	10	27324754	missense	possibly damaging	0.65
R1574:Lama2	UTSW	10	27324754	missense	possibly damaging	0.65
R1645:Lama2	UTSW	10	27368985	missense	probably damaging	1.00
R1702:Lama2	UTSW	10	27190529	missense	probably benign
R1703:Lama2	UTSW	10	27266671	missense	probably damaging	1.00
R1769:Lama2	UTSW	10	27208407	missense	probably benign
R1846:Lama2	UTSW	10	27212096	missense	probably damaging	1.00
R1859:Lama2	UTSW	10	27031082	missense	possibly damaging	0.51
R1871:Lama2	UTSW	10	26984494	missense	probably damaging	1.00
R1903:Lama2	UTSW	10	27188399	missense	probably damaging	1.00
R1906:Lama2	UTSW	10	27056527	critical splice donor site	probably null
R1958:Lama2	UTSW	10	26981598	missense	probably damaging	0.97
R1959:Lama2	UTSW	10	27422618	missense	probably damaging	1.00
R1977:Lama2	UTSW	10	26990800	splice site	probably null
R2063:Lama2	UTSW	10	27164926	missense	probably damaging	1.00
R2079:Lama2	UTSW	10	27369053	missense	probably damaging	0.99
R2085:Lama2	UTSW	10	27204841	nonsense	probably null
R2125:Lama2	UTSW	10	27044453	nonsense	probably null
R2140:Lama2	UTSW	10	27054694	splice site	probably null
R2219:Lama2	UTSW	10	27043569	missense	probably damaging	0.99
R2259:Lama2	UTSW	10	27031127	missense	probably benign	0.00
R2265:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2266:Lama2	UTSW	10	26986797	missense	probably benign	0.02
R2267:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2268:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2269:Lama2	UTSW	10	26992936	missense	probably damaging	1.00
R2862:Lama2	UTSW	10	27422612	nonsense	probably null
R2912:Lama2	UTSW	10	27000803	missense	probably benign
R2999:Lama2	UTSW	10	26989421	missense	probably benign	0.18
R3034:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3081:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3107:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3109:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3436:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3437:Lama2	UTSW	10	27001235	missense	probably benign	0.11
R3706:Lama2	UTSW	10	27138996	missense	probably damaging	1.00
R3780:Lama2	UTSW	10	27459339	missense	probably damaging	1.00
R3807:Lama2	UTSW	10	27190665	frame shift	probably null
R3919:Lama2	UTSW	10	27118505	missense	probably damaging	1.00
R4014:Lama2	UTSW	10	26984376	missense	probably damaging	1.00
R4131:Lama2	UTSW	10	27041174	missense	probably benign	0.00
R4190:Lama2	UTSW	10	27266664	missense	probably damaging	0.96
R4273:Lama2	UTSW	10	27347054	missense	probably damaging	1.00
R4358:Lama2	UTSW	10	26984493	missense	probably damaging	1.00
R4407:Lama2	UTSW	10	27212128	small deletion	probably benign
R4415:Lama2	UTSW	10	26989344	nonsense	probably null
R4426:Lama2	UTSW	10	27422558	missense	probably damaging	1.00
R4590:Lama2	UTSW	10	26989414	missense	probably benign	0.00
R4615:Lama2	UTSW	10	26981524	missense	probably damaging	0.99
R4736:Lama2	UTSW	10	27204929	missense	probably damaging	1.00
R4754:Lama2	UTSW	10	27118531	missense	possibly damaging	0.58
R4791:Lama2	UTSW	10	27467271	missense	probably damaging	1.00
R4834:Lama2	UTSW	10	27006749	missense	probably benign	0.30
R4856:Lama2	UTSW	10	27043643	frame shift	probably null
R4858:Lama2	UTSW	10	27043643	frame shift	probably null
R4859:Lama2	UTSW	10	27043643	frame shift	probably null
R4897:Lama2	UTSW	10	27043643	frame shift	probably null
R4898:Lama2	UTSW	10	27043643	frame shift	probably null
R4899:Lama2	UTSW	10	27043643	frame shift	probably null
R4907:Lama2	UTSW	10	27164946	missense	probably benign	0.11
R4911:Lama2	UTSW	10	27138927	missense	probably damaging	1.00
R4924:Lama2	UTSW	10	27369141	missense	probably damaging	0.98
R5023:Lama2	UTSW	10	27190504	missense	probably damaging	0.97
R5057:Lama2	UTSW	10	27164986	missense	probably damaging	1.00
R5070:Lama2	UTSW	10	27350251	critical splice donor site	probably null
R5116:Lama2	UTSW	10	27118560	missense	probably benign	0.08
R5177:Lama2	UTSW	10	27190703	missense	possibly damaging	0.94
R5198:Lama2	UTSW	10	27347003	missense	probably damaging	0.96
R5289:Lama2	UTSW	10	27212073	nonsense	probably null
R5327:Lama2	UTSW	10	27138946	missense	probably benign
R5424:Lama2	UTSW	10	26984396	missense	probably damaging	1.00
R5469:Lama2	UTSW	10	27041189	missense	possibly damaging	0.92
R5620:Lama2	UTSW	10	26990880	missense	probably damaging	0.99
R5667:Lama2	UTSW	10	27190544	missense	probably damaging	1.00
R5671:Lama2	UTSW	10	27190544	missense	probably damaging	1.00
R5815:Lama2	UTSW	10	26986851	missense	probably damaging	1.00
R5917:Lama2	UTSW	10	27190697	missense	probably damaging	1.00
R5935:Lama2	UTSW	10	27015498	missense	probably benign
R5976:Lama2	UTSW	10	27190676	missense	probably benign	0.00
R5979:Lama2	UTSW	10	27235732	missense	probably damaging	0.99
R6004:Lama2	UTSW	10	27235785	missense	probably benign	0.01
R6180:Lama2	UTSW	10	26981499	missense	probably benign	0.03
R6198:Lama2	UTSW	10	27188022	missense	probably damaging	1.00
R6257:Lama2	UTSW	10	26986899	missense	possibly damaging	0.85
R6271:Lama2	UTSW	10	27023329	missense	possibly damaging	0.67
R6322:Lama2	UTSW	10	27190547	missense	probably damaging	0.96
R6354:Lama2	UTSW	10	27212068	missense	probably damaging	1.00
R6431:Lama2	UTSW	10	27053031	missense	possibly damaging	0.50
R6499:Lama2	UTSW	10	27031158	missense	probably damaging	1.00
R6535:Lama2	UTSW	10	27104131	missense	probably damaging	1.00
R6545:Lama2	UTSW	10	27176797	missense	probably benign
R6636:Lama2	UTSW	10	27124568	missense	probably benign	0.13
R6891:Lama2	UTSW	10	27328072	nonsense	probably null
R6891:Lama2	UTSW	10	27328082	nonsense	probably null
R6902:Lama2	UTSW	10	26981629	missense	probably damaging	1.00
R6908:Lama2	UTSW	10	27031196	splice site	probably null
R7168:Lama2	UTSW	10	27366152	critical splice acceptor site	probably null
R7233:Lama2	UTSW	10	27231663	missense	probably damaging	1.00
R7272:Lama2	UTSW	10	27124556	missense	probably damaging	1.00
R7274:Lama2	UTSW	10	27119980	missense	probably damaging	0.99
R7419:Lama2	UTSW	10	27266634	missense	probably benign
R7423:Lama2	UTSW	10	27212226	missense	probably benign	0.00
R7554:Lama2	UTSW	10	27155496	missense	probably damaging	1.00
R7569:Lama2	UTSW	10	27265050	missense	probably damaging	1.00
R7574:Lama2	UTSW	10	27006730	missense	probably benign	0.03
R7584:Lama2	UTSW	10	27104261	missense	possibly damaging	0.78
R7586:Lama2	UTSW	10	27101393	missense	probably benign	0.00
R7603:Lama2	UTSW	10	27266680	missense	possibly damaging	0.55
R7691:Lama2	UTSW	10	27208393	missense	possibly damaging	0.67
R7750:Lama2	UTSW	10	26990924	missense	probably damaging	0.97
R7841:Lama2	UTSW	10	27155533	missense	probably benign	0.00
R7864:Lama2	UTSW	10	27056615	missense	probably benign	0.08
R7960:Lama2	UTSW	10	26993098	missense	probably benign	0.04
R7964:Lama2	UTSW	10	27223981	critical splice donor site	probably null
R7980:Lama2	UTSW	10	27363613	missense	probably damaging	0.98
R8013:Lama2	UTSW	10	27344498	missense	probably benign	0.00
R8028:Lama2	UTSW	10	27328149	missense	probably benign	0.13
R8097:Lama2	UTSW	10	27190664	nonsense	probably null
R8100:Lama2	UTSW	10	27041117	missense	probably benign	0.03
R8110:Lama2	UTSW	10	26990870	missense	probably damaging	1.00
R8122:Lama2	UTSW	10	27054596	missense	possibly damaging	0.87
R8264:Lama2	UTSW	10	27467222	missense	probably benign	0.07
R8315:Lama2	UTSW	10	27422659	missense	probably damaging	1.00
R8318:Lama2	UTSW	10	26984338	missense	probably damaging	1.00
R8419:Lama2	UTSW	10	27422563	missense	probably benign	0.26
R8475:Lama2	UTSW	10	27101373	missense	possibly damaging	0.69
R8735:Lama2	UTSW	10	27190534	missense	probably damaging	1.00
R8754:Lama2	UTSW	10	27001151	missense	possibly damaging	0.83
R8817:Lama2	UTSW	10	27187873	missense	probably damaging	1.00
R8851:Lama2	UTSW	10	27366123	missense	possibly damaging	0.94
R8859:Lama2	UTSW	10	27459388	missense	possibly damaging	0.58
R8886:Lama2	UTSW	10	27369161	splice site	probably benign
R8937:Lama2	UTSW	10	26986820	missense	probably damaging	1.00
R8993:Lama2	UTSW	10	27422714	missense	possibly damaging	0.91
R9025:Lama2	UTSW	10	26984371	missense	probably benign	0.00
R9027:Lama2	UTSW	10	27204885	missense	probably damaging	1.00
R9047:Lama2	UTSW	10	27006701	missense	possibly damaging	0.50
R9075:Lama2	UTSW	10	26981592	missense	probably damaging	1.00
R9135:Lama2	UTSW	10	27422519	missense	probably damaging	1.00
R9165:Lama2	UTSW	10	27053026	critical splice donor site	probably null
R9192:Lama2	UTSW	10	27328185	missense	possibly damaging	0.95
R9254:Lama2	UTSW	10	27422689	missense	probably damaging	0.96
R9326:Lama2	UTSW	10	27030197	missense	probably benign	0.04
R9356:Lama2	UTSW	10	27212190	missense	probably damaging	0.99
R9358:Lama2	UTSW	10	27188382	missense	possibly damaging	0.95
R9358:Lama2	UTSW	10	27616765	missense	unknown
R9376:Lama2	UTSW	10	27118624	missense	probably benign	0.11
R9381:Lama2	UTSW	10	27188027	nonsense	probably null
R9397:Lama2	UTSW	10	27105121	missense	probably benign	0.01
R9460:Lama2	UTSW	10	27422479	missense	probably damaging	1.00
R9478:Lama2	UTSW	10	27015482	missense	probably damaging	0.98
R9503:Lama2	UTSW	10	26989444	missense	possibly damaging	0.57
R9514:Lama2	UTSW	10	27224019	missense	probably benign	0.00
R9515:Lama2	UTSW	10	27001174	missense	probably benign	0.23
R9516:Lama2	UTSW	10	27224019	missense	probably benign	0.00
R9533:Lama2	UTSW	10	26986875	missense	probably damaging	1.00
R9619:Lama2	UTSW	10	27188286	missense	probably damaging	1.00
R9721:Lama2	UTSW	10	27467342	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- ACAGGCTCAATGCACCTGCCTTAG -3'
(R):5'- TGTCATACGGATTTTCAGCCCTGC -3'

Sequencing Primer
(F):5'- GGTGGTGTTCACTAACCTCAAAAG -3'
(R):5'- GATTTTCAGCCCTGCAAATCTTG -3'

Posted On

2014-05-23