Incidental Mutation 'R1769:Slc5a8'
ID 194713
Institutional Source Beutler Lab
Gene Symbol Slc5a8
Ensembl Gene ENSMUSG00000020062
Gene Name solute carrier family 5 (iodide transporter), member 8
Synonyms SMCT
MMRRC Submission 039800-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1769 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 88721854-88765377 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 88755328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 478 (Y478*)
Ref Sequence ENSEMBL: ENSMUSP00000020255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020255]
AlphaFold Q8BYF6
Predicted Effect probably null
Transcript: ENSMUST00000020255
AA Change: Y478*
SMART Domains Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: Y478*

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:SSF 45 449 2.6e-38 PFAM
low complexity region 462 478 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik A G 5: 138,644,519 (GRCm39) I135V probably benign Het
Abca1 T A 4: 53,074,325 (GRCm39) K1119N probably damaging Het
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Abcc9 T C 6: 142,573,194 (GRCm39) probably benign Het
Akap3 A G 6: 126,842,809 (GRCm39) E476G possibly damaging Het
Aldh3b1 A G 19: 3,968,740 (GRCm39) F271S probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ascc3 T C 10: 50,576,586 (GRCm39) V847A probably damaging Het
Best3 A G 10: 116,859,883 (GRCm39) N381S probably benign Het
Blm A T 7: 80,163,118 (GRCm39) S78T probably benign Het
Bmpr2 T A 1: 59,907,520 (GRCm39) L871Q probably damaging Het
Car13 T A 3: 14,715,795 (GRCm39) H104Q probably benign Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Ccnb1ip1 T C 14: 51,029,568 (GRCm39) M165V probably benign Het
Cd4 A T 6: 124,843,618 (GRCm39) M431K possibly damaging Het
Cdh20 C T 1: 109,980,606 (GRCm39) T178I probably damaging Het
Ceacam3 C T 7: 16,892,301 (GRCm39) T348I probably damaging Het
Cfap54 C T 10: 92,740,125 (GRCm39) probably null Het
Clcn6 A T 4: 148,098,758 (GRCm39) probably null Het
Csf3 A G 11: 98,593,246 (GRCm39) Y121C probably damaging Het
Csmd3 C T 15: 47,567,505 (GRCm39) probably benign Het
Cyp2c69 A G 19: 39,864,815 (GRCm39) I221T probably benign Het
Dgcr2 T C 16: 17,675,115 (GRCm39) probably benign Het
Dhcr7 T C 7: 143,401,250 (GRCm39) F474S probably damaging Het
Dnah1 T C 14: 31,032,839 (GRCm39) I399V probably null Het
Efcab14 T A 4: 115,610,188 (GRCm39) L183Q probably damaging Het
Evx2 A G 2: 74,489,501 (GRCm39) V88A probably benign Het
Exph5 A G 9: 53,285,109 (GRCm39) N730S probably benign Het
Farsb T A 1: 78,443,620 (GRCm39) K196I probably benign Het
Fbln7 C T 2: 128,735,682 (GRCm39) probably benign Het
Fhdc1 A G 3: 84,356,085 (GRCm39) F453S probably damaging Het
Gast T A 11: 100,227,684 (GRCm39) W89R probably damaging Het
Gata2 A G 6: 88,182,237 (GRCm39) S402G probably benign Het
Gin1 T A 1: 97,720,162 (GRCm39) S386T probably benign Het
Golgb1 A G 16: 36,736,363 (GRCm39) E1870G probably damaging Het
Hivep3 T A 4: 119,954,768 (GRCm39) V1028E possibly damaging Het
Ifi203 G A 1: 173,756,326 (GRCm39) R486* probably null Het
Ifi209 G A 1: 173,468,728 (GRCm39) S186N probably benign Het
Ifih1 C T 2: 62,436,738 (GRCm39) A562T probably damaging Het
Itch T C 2: 155,014,481 (GRCm39) L106S probably damaging Het
Itga4 T A 2: 79,146,050 (GRCm39) probably null Het
Kdm4c A G 4: 74,199,234 (GRCm39) S141G possibly damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klra3 T C 6: 130,307,226 (GRCm39) probably null Het
Lama2 G C 10: 27,084,403 (GRCm39) F922L probably benign Het
Lama2 A T 10: 27,084,402 (GRCm39) S923T probably damaging Het
Llgl1 G A 11: 60,597,873 (GRCm39) V331M probably damaging Het
Lrrc30 T C 17: 67,938,676 (GRCm39) *301W probably null Het
Map1lc3b C T 8: 122,320,226 (GRCm39) probably benign Het
Mbd2 A G 18: 70,749,690 (GRCm39) I302V probably benign Het
Med27 A G 2: 29,390,307 (GRCm39) Y78C probably damaging Het
Mei1 C T 15: 81,996,771 (GRCm39) probably null Het
Mideas G A 12: 84,205,124 (GRCm39) probably benign Het
Miga1 T C 3: 151,993,191 (GRCm39) E346G probably damaging Het
Myef2 A G 2: 124,957,363 (GRCm39) S131P probably damaging Het
Myocd T C 11: 65,069,527 (GRCm39) H899R probably benign Het
Ncam1 A G 9: 49,456,556 (GRCm39) probably benign Het
Ngf T A 3: 102,427,513 (GRCm39) N87K possibly damaging Het
Nol10 T A 12: 17,466,709 (GRCm39) probably benign Het
Nrip2 A G 6: 128,385,231 (GRCm39) I221V probably benign Het
Nup205 G A 6: 35,182,366 (GRCm39) G777D probably damaging Het
Or5ac17 A G 16: 59,036,344 (GRCm39) F211L probably benign Het
Or5b96 A G 19: 12,867,047 (GRCm39) V298A probably damaging Het
Or6c1 T A 10: 129,518,081 (GRCm39) T176S probably benign Het
Or7g35 A T 9: 19,496,682 (GRCm39) Q283L probably damaging Het
Or8d6 G T 9: 39,854,251 (GRCm39) D232Y probably benign Het
Oxt A T 2: 130,418,220 (GRCm39) R31W probably damaging Het
Pde4dip A G 3: 97,603,246 (GRCm39) S2248P probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pkp2 T C 16: 16,080,561 (GRCm39) S616P probably damaging Het
Plch2 T C 4: 155,084,540 (GRCm39) Y379C probably damaging Het
Pnpt1 A G 11: 29,104,159 (GRCm39) N540D probably benign Het
Ptpn23 G A 9: 110,220,746 (GRCm39) H255Y possibly damaging Het
Rad21 T C 15: 51,835,703 (GRCm39) N237D probably benign Het
Ryr3 A C 2: 112,582,113 (GRCm39) probably null Het
Sgk1 C A 10: 21,873,007 (GRCm39) probably benign Het
Slc1a5 G T 7: 16,531,464 (GRCm39) A490S probably damaging Het
Slc9a3 A T 13: 74,311,190 (GRCm39) M562L probably benign Het
Spmip4 A G 6: 50,568,801 (GRCm39) probably benign Het
Thsd7a G A 6: 12,555,714 (GRCm39) R57* probably null Het
Tiam1 T C 16: 89,657,167 (GRCm39) R690G probably damaging Het
Tmem150b A G 7: 4,727,365 (GRCm39) S47P probably damaging Het
Trim39 C T 17: 36,574,832 (GRCm39) R190Q probably damaging Het
Ttc32 A T 12: 9,085,073 (GRCm39) I98L possibly damaging Het
Vps13c A G 9: 67,873,003 (GRCm39) T3304A probably benign Het
Wdr35 A C 12: 9,062,728 (GRCm39) D638A probably damaging Het
Wwc1 G T 11: 35,752,671 (GRCm39) P797T probably benign Het
Zan T A 5: 137,462,780 (GRCm39) T800S unknown Het
Zbbx A G 3: 74,990,926 (GRCm39) probably benign Het
Zup1 T C 10: 33,811,172 (GRCm39) M291V probably damaging Het
Other mutations in Slc5a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Slc5a8 APN 10 88,743,902 (GRCm39) missense possibly damaging 0.91
IGL00902:Slc5a8 APN 10 88,755,323 (GRCm39) missense probably benign 0.03
IGL00960:Slc5a8 APN 10 88,757,627 (GRCm39) missense probably benign 0.21
IGL01109:Slc5a8 APN 10 88,742,254 (GRCm39) missense possibly damaging 0.95
IGL01365:Slc5a8 APN 10 88,727,959 (GRCm39) splice site probably benign
IGL01418:Slc5a8 APN 10 88,740,895 (GRCm39) missense probably damaging 1.00
IGL01823:Slc5a8 APN 10 88,755,334 (GRCm39) nonsense probably null
IGL02116:Slc5a8 APN 10 88,755,362 (GRCm39) missense probably benign
IGL03109:Slc5a8 APN 10 88,742,278 (GRCm39) splice site probably benign
PIT4585001:Slc5a8 UTSW 10 88,722,365 (GRCm39) missense probably damaging 1.00
R0010:Slc5a8 UTSW 10 88,722,452 (GRCm39) missense probably benign 0.03
R0418:Slc5a8 UTSW 10 88,722,420 (GRCm39) missense probably benign 0.01
R1233:Slc5a8 UTSW 10 88,754,304 (GRCm39) missense probably damaging 1.00
R1656:Slc5a8 UTSW 10 88,761,648 (GRCm39) critical splice donor site probably null
R1769:Slc5a8 UTSW 10 88,755,326 (GRCm39) missense probably benign
R2870:Slc5a8 UTSW 10 88,740,825 (GRCm39) missense probably benign 0.01
R2870:Slc5a8 UTSW 10 88,740,825 (GRCm39) missense probably benign 0.01
R2873:Slc5a8 UTSW 10 88,740,825 (GRCm39) missense probably benign 0.01
R3883:Slc5a8 UTSW 10 88,738,325 (GRCm39) missense possibly damaging 0.89
R4207:Slc5a8 UTSW 10 88,747,275 (GRCm39) missense probably damaging 1.00
R4731:Slc5a8 UTSW 10 88,761,649 (GRCm39) critical splice donor site probably null
R4880:Slc5a8 UTSW 10 88,727,886 (GRCm39) missense probably damaging 1.00
R4969:Slc5a8 UTSW 10 88,740,774 (GRCm39) splice site probably null
R4998:Slc5a8 UTSW 10 88,743,919 (GRCm39) critical splice donor site probably null
R5009:Slc5a8 UTSW 10 88,745,516 (GRCm39) missense probably benign 0.07
R5068:Slc5a8 UTSW 10 88,722,460 (GRCm39) missense possibly damaging 0.82
R5069:Slc5a8 UTSW 10 88,722,460 (GRCm39) missense possibly damaging 0.82
R5070:Slc5a8 UTSW 10 88,722,460 (GRCm39) missense possibly damaging 0.82
R5130:Slc5a8 UTSW 10 88,762,077 (GRCm39) missense probably benign
R5141:Slc5a8 UTSW 10 88,755,422 (GRCm39) critical splice donor site probably null
R5252:Slc5a8 UTSW 10 88,742,209 (GRCm39) missense probably damaging 1.00
R5659:Slc5a8 UTSW 10 88,755,290 (GRCm39) missense possibly damaging 0.89
R5660:Slc5a8 UTSW 10 88,755,290 (GRCm39) missense possibly damaging 0.89
R5661:Slc5a8 UTSW 10 88,755,290 (GRCm39) missense possibly damaging 0.89
R6039:Slc5a8 UTSW 10 88,722,436 (GRCm39) missense probably benign 0.00
R6039:Slc5a8 UTSW 10 88,722,436 (GRCm39) missense probably benign 0.00
R6378:Slc5a8 UTSW 10 88,740,916 (GRCm39) missense probably damaging 1.00
R7214:Slc5a8 UTSW 10 88,755,364 (GRCm39) missense probably benign
R7255:Slc5a8 UTSW 10 88,745,493 (GRCm39) missense probably damaging 1.00
R7526:Slc5a8 UTSW 10 88,738,353 (GRCm39) missense probably damaging 1.00
R7604:Slc5a8 UTSW 10 88,740,822 (GRCm39) missense possibly damaging 0.78
R7688:Slc5a8 UTSW 10 88,757,561 (GRCm39) missense probably damaging 1.00
R7869:Slc5a8 UTSW 10 88,757,567 (GRCm39) missense probably benign 0.15
R8219:Slc5a8 UTSW 10 88,757,561 (GRCm39) missense probably damaging 1.00
R8474:Slc5a8 UTSW 10 88,757,552 (GRCm39) missense possibly damaging 0.69
R8937:Slc5a8 UTSW 10 88,740,885 (GRCm39) missense probably damaging 1.00
R8960:Slc5a8 UTSW 10 88,722,035 (GRCm39) start gained probably benign
R9000:Slc5a8 UTSW 10 88,762,090 (GRCm39) missense probably benign 0.13
R9000:Slc5a8 UTSW 10 88,762,089 (GRCm39) missense probably benign 0.00
R9792:Slc5a8 UTSW 10 88,757,591 (GRCm39) missense possibly damaging 0.55
R9795:Slc5a8 UTSW 10 88,757,591 (GRCm39) missense possibly damaging 0.55
Z1177:Slc5a8 UTSW 10 88,745,475 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGGCTTTGACCAGGTTGATCC -3'
(R):5'- GTCCACTCAATGCAGGCATAGGAAG -3'

Sequencing Primer
(F):5'- TGACCAGGTTGATCCTAACTTTC -3'
(R):5'- GCAGTGTCATAAGCAAGATaaaaac -3'
Posted On 2014-05-23