Mutagenetix > Incidental Mutation

Incidental Mutation 'R1769:Slc5a8'

194713

Institutional Source

Beutler Lab

Gene Symbol

Slc5a8

Ensembl Gene

ENSMUSG00000020062

Gene Name

solute carrier family 5 (iodide transporter), member 8

Synonyms

SMCT

MMRRC Submission

039800-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1769 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88885992-88929515 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 88919466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 478 (Y478*)

Ref Sequence

ENSEMBL: ENSMUSP00000020255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020255]

AlphaFold

Q8BYF6

Predicted Effect

probably null
Transcript: ENSMUST00000020255
AA Change: Y478*

SMART Domains

Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: Y478*

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:SSF	45	449	2.6e-38	PFAM
low complexity region	462	478	N/A	INTRINSIC
transmembrane domain	519	541	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	G	6: 50,591,821		probably benign	Het
A430033K04Rik	A	G	5: 138,646,257	I135V	probably benign	Het
Abca1	T	A	4: 53,074,325	K1119N	probably damaging	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Abcc9	T	C	6: 142,627,468		probably benign	Het
Akap3	A	G	6: 126,865,846	E476G	possibly damaging	Het
Aldh3b1	A	G	19: 3,918,740	F271S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ascc3	T	C	10: 50,700,490	V847A	probably damaging	Het
Best3	A	G	10: 117,023,978	N381S	probably benign	Het
Blm	A	T	7: 80,513,370	S78T	probably benign	Het
Bmpr2	T	A	1: 59,868,361	L871Q	probably damaging	Het
Car13	T	A	3: 14,650,735	H104Q	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Ccnb1ip1	T	C	14: 50,792,111	M165V	probably benign	Het
Cd4	A	T	6: 124,866,655	M431K	possibly damaging	Het
Cdh7	C	T	1: 110,052,876	T178I	probably damaging	Het
Ceacam3	C	T	7: 17,158,376	T348I	probably damaging	Het
Cfap54	C	T	10: 92,904,263		probably null	Het
Clcn6	A	T	4: 148,014,301		probably null	Het
Csf3	A	G	11: 98,702,420	Y121C	probably damaging	Het
Csmd3	C	T	15: 47,704,109		probably benign	Het
Cyp2c69	A	G	19: 39,876,371	I221T	probably benign	Het
Dgcr2	T	C	16: 17,857,251		probably benign	Het
Dhcr7	T	C	7: 143,847,513	F474S	probably damaging	Het
Dnah1	T	C	14: 31,310,882	I399V	probably null	Het
Efcab14	T	A	4: 115,752,991	L183Q	probably damaging	Het
Elmsan1	G	A	12: 84,158,350		probably benign	Het
Evx2	A	G	2: 74,659,157	V88A	probably benign	Het
Exph5	A	G	9: 53,373,809	N730S	probably benign	Het
Farsb	T	A	1: 78,466,983	K196I	probably benign	Het
Fbln7	C	T	2: 128,893,762		probably benign	Het
Fhdc1	A	G	3: 84,448,778	F453S	probably damaging	Het
Gast	T	A	11: 100,336,858	W89R	probably damaging	Het
Gata2	A	G	6: 88,205,255	S402G	probably benign	Het
Gin1	T	A	1: 97,792,437	S386T	probably benign	Het
Golgb1	A	G	16: 36,916,001	E1870G	probably damaging	Het
Hivep3	T	A	4: 120,097,571	V1028E	possibly damaging	Het
Ifi203	G	A	1: 173,928,760	R486*	probably null	Het
Ifi209	G	A	1: 173,641,162	S186N	probably benign	Het
Ifih1	C	T	2: 62,606,394	A562T	probably damaging	Het
Itch	T	C	2: 155,172,561	L106S	probably damaging	Het
Itga4	T	A	2: 79,315,706		probably null	Het
Kdm4c	A	G	4: 74,280,997	S141G	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra3	T	C	6: 130,330,263		probably null	Het
Lama2	A	T	10: 27,208,406	S923T	probably damaging	Het
Lama2	G	C	10: 27,208,407	F922L	probably benign	Het
Llgl1	G	A	11: 60,707,047	V331M	probably damaging	Het
Lrrc30	T	C	17: 67,631,681	*301W	probably null	Het
Map1lc3b	C	T	8: 121,593,487		probably benign	Het
Mbd2	A	G	18: 70,616,619	I302V	probably benign	Het
Med27	A	G	2: 29,500,295	Y78C	probably damaging	Het
Mei1	C	T	15: 82,112,570		probably null	Het
Miga1	T	C	3: 152,287,554	E346G	probably damaging	Het
Myef2	A	G	2: 125,115,443	S131P	probably damaging	Het
Myocd	T	C	11: 65,178,701	H899R	probably benign	Het
Ncam1	A	G	9: 49,545,256		probably benign	Het
Ngf	T	A	3: 102,520,197	N87K	possibly damaging	Het
Nol10	T	A	12: 17,416,708		probably benign	Het
Nrip2	A	G	6: 128,408,268	I221V	probably benign	Het
Nup205	G	A	6: 35,205,431	G777D	probably damaging	Het
Olfr1446	A	G	19: 12,889,683	V298A	probably damaging	Het
Olfr199	A	G	16: 59,215,981	F211L	probably benign	Het
Olfr802	T	A	10: 129,682,212	T176S	probably benign	Het
Olfr855	A	T	9: 19,585,386	Q283L	probably damaging	Het
Olfr974	G	T	9: 39,942,955	D232Y	probably benign	Het
Oxt	A	T	2: 130,576,300	R31W	probably damaging	Het
Pde4dip	A	G	3: 97,695,930	S2248P	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pkp2	T	C	16: 16,262,697	S616P	probably damaging	Het
Plch2	T	C	4: 155,000,083	Y379C	probably damaging	Het
Pnpt1	A	G	11: 29,154,159	N540D	probably benign	Het
Ptpn23	G	A	9: 110,391,678	H255Y	possibly damaging	Het
Rad21	T	C	15: 51,972,307	N237D	probably benign	Het
Ryr3	A	C	2: 112,751,768		probably null	Het
Sgk1	C	A	10: 21,997,108		probably benign	Het
Slc1a5	G	T	7: 16,797,539	A490S	probably damaging	Het
Slc9a3	A	T	13: 74,163,071	M562L	probably benign	Het
Thsd7a	G	A	6: 12,555,715	R57*	probably null	Het
Tiam1	T	C	16: 89,860,279	R690G	probably damaging	Het
Tmem150b	A	G	7: 4,724,366	S47P	probably damaging	Het
Trim39	C	T	17: 36,263,940	R190Q	probably damaging	Het
Ttc32	A	T	12: 9,035,073	I98L	possibly damaging	Het
Vps13c	A	G	9: 67,965,721	T3304A	probably benign	Het
Wdr35	A	C	12: 9,012,728	D638A	probably damaging	Het
Wwc1	G	T	11: 35,861,844	P797T	probably benign	Het
Zan	T	A	5: 137,464,518	T800S	unknown	Het
Zbbx	A	G	3: 75,083,619		probably benign	Het
Zufsp	T	C	10: 33,935,176	M291V	probably damaging	Het

Other mutations in Slc5a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Slc5a8	APN	10	88908040	missense	possibly damaging	0.91
IGL00902:Slc5a8	APN	10	88919461	missense	probably benign	0.03
IGL00960:Slc5a8	APN	10	88921765	missense	probably benign	0.21
IGL01109:Slc5a8	APN	10	88906392	missense	possibly damaging	0.95
IGL01365:Slc5a8	APN	10	88892097	splice site	probably benign
IGL01418:Slc5a8	APN	10	88905033	missense	probably damaging	1.00
IGL01823:Slc5a8	APN	10	88919472	nonsense	probably null
IGL02116:Slc5a8	APN	10	88919500	missense	probably benign
IGL03109:Slc5a8	APN	10	88906416	splice site	probably benign
PIT4585001:Slc5a8	UTSW	10	88886503	missense	probably damaging	1.00
R0010:Slc5a8	UTSW	10	88886590	missense	probably benign	0.03
R0418:Slc5a8	UTSW	10	88886558	missense	probably benign	0.01
R1233:Slc5a8	UTSW	10	88918442	missense	probably damaging	1.00
R1656:Slc5a8	UTSW	10	88925786	critical splice donor site	probably null
R1769:Slc5a8	UTSW	10	88919464	missense	probably benign
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2873:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R3883:Slc5a8	UTSW	10	88902463	missense	possibly damaging	0.89
R4207:Slc5a8	UTSW	10	88911413	missense	probably damaging	1.00
R4731:Slc5a8	UTSW	10	88925787	critical splice donor site	probably null
R4880:Slc5a8	UTSW	10	88892024	missense	probably damaging	1.00
R4969:Slc5a8	UTSW	10	88904912	splice site	probably null
R4998:Slc5a8	UTSW	10	88908057	critical splice donor site	probably null
R5009:Slc5a8	UTSW	10	88909654	missense	probably benign	0.07
R5068:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5069:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5070:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5130:Slc5a8	UTSW	10	88926215	missense	probably benign
R5141:Slc5a8	UTSW	10	88919560	critical splice donor site	probably null
R5252:Slc5a8	UTSW	10	88906347	missense	probably damaging	1.00
R5659:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5660:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5661:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6378:Slc5a8	UTSW	10	88905054	missense	probably damaging	1.00
R7214:Slc5a8	UTSW	10	88919502	missense	probably benign
R7255:Slc5a8	UTSW	10	88909631	missense	probably damaging	1.00
R7526:Slc5a8	UTSW	10	88902491	missense	probably damaging	1.00
R7604:Slc5a8	UTSW	10	88904960	missense	possibly damaging	0.78
R7688:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R7869:Slc5a8	UTSW	10	88921705	missense	probably benign	0.15
R8219:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R8474:Slc5a8	UTSW	10	88921690	missense	possibly damaging	0.69
R8937:Slc5a8	UTSW	10	88905023	missense	probably damaging	1.00
R8960:Slc5a8	UTSW	10	88886173	start gained	probably benign
R9000:Slc5a8	UTSW	10	88926227	missense	probably benign	0.00
R9000:Slc5a8	UTSW	10	88926228	missense	probably benign	0.13
R9792:Slc5a8	UTSW	10	88921729	missense	possibly damaging	0.55
R9795:Slc5a8	UTSW	10	88921729	missense	possibly damaging	0.55
Z1177:Slc5a8	UTSW	10	88909613	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTGGCTTTGACCAGGTTGATCC -3'
(R):5'- GTCCACTCAATGCAGGCATAGGAAG -3'

Sequencing Primer
(F):5'- TGACCAGGTTGATCCTAACTTTC -3'
(R):5'- GCAGTGTCATAAGCAAGATaaaaac -3'

Posted On

2014-05-23