Incidental Mutation 'R1769:Llgl1'
ID194719
Institutional Source Beutler Lab
Gene Symbol Llgl1
Ensembl Gene ENSMUSG00000020536
Gene NameLLGL1 scribble cell polarity complex component
SynonymsLgl1
MMRRC Submission 039800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1769 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60699723-60714186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60707047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 331 (V331M)
Ref Sequence ENSEMBL: ENSMUSP00000104359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably damaging
Transcript: ENSMUST00000052346
AA Change: V331M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: V331M

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108719
AA Change: V331M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: V331M

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128749
Meta Mutation Damage Score 0.5173 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,591,821 probably benign Het
A430033K04Rik A G 5: 138,646,257 I135V probably benign Het
Abca1 T A 4: 53,074,325 K1119N probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Abcc9 T C 6: 142,627,468 probably benign Het
Akap3 A G 6: 126,865,846 E476G possibly damaging Het
Aldh3b1 A G 19: 3,918,740 F271S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ascc3 T C 10: 50,700,490 V847A probably damaging Het
Best3 A G 10: 117,023,978 N381S probably benign Het
Blm A T 7: 80,513,370 S78T probably benign Het
Bmpr2 T A 1: 59,868,361 L871Q probably damaging Het
Car13 T A 3: 14,650,735 H104Q probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ccnb1ip1 T C 14: 50,792,111 M165V probably benign Het
Cd4 A T 6: 124,866,655 M431K possibly damaging Het
Cdh7 C T 1: 110,052,876 T178I probably damaging Het
Ceacam3 C T 7: 17,158,376 T348I probably damaging Het
Cfap54 C T 10: 92,904,263 probably null Het
Clcn6 A T 4: 148,014,301 probably null Het
Csf3 A G 11: 98,702,420 Y121C probably damaging Het
Csmd3 C T 15: 47,704,109 probably benign Het
Cyp2c69 A G 19: 39,876,371 I221T probably benign Het
Dgcr2 T C 16: 17,857,251 probably benign Het
Dhcr7 T C 7: 143,847,513 F474S probably damaging Het
Dnah1 T C 14: 31,310,882 I399V probably null Het
Efcab14 T A 4: 115,752,991 L183Q probably damaging Het
Elmsan1 G A 12: 84,158,350 probably benign Het
Evx2 A G 2: 74,659,157 V88A probably benign Het
Exph5 A G 9: 53,373,809 N730S probably benign Het
Farsb T A 1: 78,466,983 K196I probably benign Het
Fbln7 C T 2: 128,893,762 probably benign Het
Fhdc1 A G 3: 84,448,778 F453S probably damaging Het
Gast T A 11: 100,336,858 W89R probably damaging Het
Gata2 A G 6: 88,205,255 S402G probably benign Het
Gin1 T A 1: 97,792,437 S386T probably benign Het
Golgb1 A G 16: 36,916,001 E1870G probably damaging Het
Hivep3 T A 4: 120,097,571 V1028E possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Ifi209 G A 1: 173,641,162 S186N probably benign Het
Ifih1 C T 2: 62,606,394 A562T probably damaging Het
Itch T C 2: 155,172,561 L106S probably damaging Het
Itga4 T A 2: 79,315,706 probably null Het
Kdm4c A G 4: 74,280,997 S141G possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra3 T C 6: 130,330,263 probably null Het
Lama2 A T 10: 27,208,406 S923T probably damaging Het
Lama2 G C 10: 27,208,407 F922L probably benign Het
Lrrc30 T C 17: 67,631,681 *301W probably null Het
Map1lc3b C T 8: 121,593,487 probably benign Het
Mbd2 A G 18: 70,616,619 I302V probably benign Het
Med27 A G 2: 29,500,295 Y78C probably damaging Het
Mei1 C T 15: 82,112,570 probably null Het
Miga1 T C 3: 152,287,554 E346G probably damaging Het
Myef2 A G 2: 125,115,443 S131P probably damaging Het
Myocd T C 11: 65,178,701 H899R probably benign Het
Ncam1 A G 9: 49,545,256 probably benign Het
Ngf T A 3: 102,520,197 N87K possibly damaging Het
Nol10 T A 12: 17,416,708 probably benign Het
Nrip2 A G 6: 128,408,268 I221V probably benign Het
Nup205 G A 6: 35,205,431 G777D probably damaging Het
Olfr1446 A G 19: 12,889,683 V298A probably damaging Het
Olfr199 A G 16: 59,215,981 F211L probably benign Het
Olfr802 T A 10: 129,682,212 T176S probably benign Het
Olfr855 A T 9: 19,585,386 Q283L probably damaging Het
Olfr974 G T 9: 39,942,955 D232Y probably benign Het
Oxt A T 2: 130,576,300 R31W probably damaging Het
Pde4dip A G 3: 97,695,930 S2248P probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pkp2 T C 16: 16,262,697 S616P probably damaging Het
Plch2 T C 4: 155,000,083 Y379C probably damaging Het
Pnpt1 A G 11: 29,154,159 N540D probably benign Het
Ptpn23 G A 9: 110,391,678 H255Y possibly damaging Het
Rad21 T C 15: 51,972,307 N237D probably benign Het
Ryr3 A C 2: 112,751,768 probably null Het
Sgk1 C A 10: 21,997,108 probably benign Het
Slc1a5 G T 7: 16,797,539 A490S probably damaging Het
Slc5a8 T C 10: 88,919,464 Y478H probably benign Het
Slc5a8 T A 10: 88,919,466 Y478* probably null Het
Slc9a3 A T 13: 74,163,071 M562L probably benign Het
Thsd7a G A 6: 12,555,715 R57* probably null Het
Tiam1 T C 16: 89,860,279 R690G probably damaging Het
Tmem150b A G 7: 4,724,366 S47P probably damaging Het
Trim39 C T 17: 36,263,940 R190Q probably damaging Het
Ttc32 A T 12: 9,035,073 I98L possibly damaging Het
Vps13c A G 9: 67,965,721 T3304A probably benign Het
Wdr35 A C 12: 9,012,728 D638A probably damaging Het
Wwc1 G T 11: 35,861,844 P797T probably benign Het
Zan T A 5: 137,464,518 T800S unknown Het
Zbbx A G 3: 75,083,619 probably benign Het
Zufsp T C 10: 33,935,176 M291V probably damaging Het
Other mutations in Llgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Llgl1 APN 11 60709999 missense probably benign 0.38
IGL01400:Llgl1 APN 11 60706490 missense probably damaging 1.00
IGL03066:Llgl1 APN 11 60706034 missense possibly damaging 0.75
IGL03174:Llgl1 APN 11 60706210 missense probably benign 0.15
IGL03306:Llgl1 APN 11 60711354 missense possibly damaging 0.92
R0284:Llgl1 UTSW 11 60712141 missense probably damaging 0.98
R1137:Llgl1 UTSW 11 60704733 missense probably benign 0.01
R1432:Llgl1 UTSW 11 60708554 missense probably damaging 1.00
R1786:Llgl1 UTSW 11 60707240 missense probably benign 0.19
R1835:Llgl1 UTSW 11 60704730 missense probably benign 0.00
R1943:Llgl1 UTSW 11 60706016 missense probably benign
R2197:Llgl1 UTSW 11 60710039 missense possibly damaging 0.62
R2510:Llgl1 UTSW 11 60710036 missense probably damaging 1.00
R2568:Llgl1 UTSW 11 60708812 missense probably damaging 1.00
R3690:Llgl1 UTSW 11 60707002 missense probably damaging 1.00
R3853:Llgl1 UTSW 11 60707249 missense probably damaging 1.00
R4079:Llgl1 UTSW 11 60710284 splice site probably null
R4259:Llgl1 UTSW 11 60709568 missense probably benign
R4348:Llgl1 UTSW 11 60709568 missense probably benign
R4349:Llgl1 UTSW 11 60709568 missense probably benign
R4352:Llgl1 UTSW 11 60709568 missense probably benign
R4353:Llgl1 UTSW 11 60709568 missense probably benign
R4396:Llgl1 UTSW 11 60706008 missense probably benign
R4584:Llgl1 UTSW 11 60712082 missense probably damaging 0.99
R4594:Llgl1 UTSW 11 60706321 missense probably benign 0.15
R4628:Llgl1 UTSW 11 60709985 missense probably damaging 1.00
R4651:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4653:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4731:Llgl1 UTSW 11 60706225 nonsense probably null
R4869:Llgl1 UTSW 11 60707210 nonsense probably null
R4898:Llgl1 UTSW 11 60709568 missense probably benign
R4899:Llgl1 UTSW 11 60709568 missense probably benign
R4939:Llgl1 UTSW 11 60709979 critical splice acceptor site probably null
R4941:Llgl1 UTSW 11 60709568 missense probably benign
R4942:Llgl1 UTSW 11 60709568 missense probably benign
R4958:Llgl1 UTSW 11 60711435 missense probably benign 0.02
R4995:Llgl1 UTSW 11 60709724 missense probably benign 0.00
R4997:Llgl1 UTSW 11 60709568 missense probably benign
R5177:Llgl1 UTSW 11 60712007 missense possibly damaging 0.94
R5257:Llgl1 UTSW 11 60711563 unclassified probably null
R5258:Llgl1 UTSW 11 60711563 unclassified probably null
R5401:Llgl1 UTSW 11 60706471 missense probably benign
R5406:Llgl1 UTSW 11 60713184 missense probably damaging 0.99
R5432:Llgl1 UTSW 11 60707623 missense probably benign
R5587:Llgl1 UTSW 11 60710342 missense probably benign 0.00
R5732:Llgl1 UTSW 11 60709460 missense probably benign 0.00
R5758:Llgl1 UTSW 11 60708567 missense probably damaging 1.00
R5879:Llgl1 UTSW 11 60712980 missense probably benign 0.00
R6268:Llgl1 UTSW 11 60712163 missense probably benign 0.13
R6286:Llgl1 UTSW 11 60709532 missense probably damaging 1.00
R6455:Llgl1 UTSW 11 60709660 missense probably damaging 0.98
R6805:Llgl1 UTSW 11 60702865 missense probably benign 0.25
R6929:Llgl1 UTSW 11 60710353 nonsense probably null
R7274:Llgl1 UTSW 11 60705986 missense possibly damaging 0.89
R7889:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
R7986:Llgl1 UTSW 11 60711395 missense probably benign 0.16
R8141:Llgl1 UTSW 11 60710316 missense probably benign 0.02
R8176:Llgl1 UTSW 11 60706561 missense probably benign 0.27
R8223:Llgl1 UTSW 11 60702822 missense possibly damaging 0.86
R8332:Llgl1 UTSW 11 60710384 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCAACAAGATTCTGTGGCGGAGC -3'
(R):5'- ACATTGGCAACATGGGCAGAGC -3'

Sequencing Primer
(F):5'- AGGATTAGGCTCCGGGTATATAG -3'
(R):5'- TGATAGCTGACGAATGCAGTG -3'
Posted On2014-05-23