Incidental Mutation 'R1769:Aldh3b1'
ID 194741
Institutional Source Beutler Lab
Gene Symbol Aldh3b1
Ensembl Gene ENSMUSG00000024885
Gene Name aldehyde dehydrogenase 3 family, member B1
Synonyms 1700001N19Rik, ALDH4, ALDH7
MMRRC Submission 039800-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R1769 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 3963491-3979808 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3968740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 271 (F271S)
Ref Sequence ENSEMBL: ENSMUSP00000056276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051803]
AlphaFold Q80VQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000051803
AA Change: F271S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056276
Gene: ENSMUSG00000024885
AA Change: F271S

DomainStartEndE-ValueType
Pfam:Aldedh 2 428 7.4e-88 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase protein family. Aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The encoded protein is able to oxidize long-chain fatty aldehydes in vitro, and may play a role in protection from oxidative stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik A G 5: 138,644,519 (GRCm39) I135V probably benign Het
Abca1 T A 4: 53,074,325 (GRCm39) K1119N probably damaging Het
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Abcc9 T C 6: 142,573,194 (GRCm39) probably benign Het
Akap3 A G 6: 126,842,809 (GRCm39) E476G possibly damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ascc3 T C 10: 50,576,586 (GRCm39) V847A probably damaging Het
Best3 A G 10: 116,859,883 (GRCm39) N381S probably benign Het
Blm A T 7: 80,163,118 (GRCm39) S78T probably benign Het
Bmpr2 T A 1: 59,907,520 (GRCm39) L871Q probably damaging Het
Car13 T A 3: 14,715,795 (GRCm39) H104Q probably benign Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Ccnb1ip1 T C 14: 51,029,568 (GRCm39) M165V probably benign Het
Cd4 A T 6: 124,843,618 (GRCm39) M431K possibly damaging Het
Cdh20 C T 1: 109,980,606 (GRCm39) T178I probably damaging Het
Ceacam3 C T 7: 16,892,301 (GRCm39) T348I probably damaging Het
Cfap54 C T 10: 92,740,125 (GRCm39) probably null Het
Clcn6 A T 4: 148,098,758 (GRCm39) probably null Het
Csf3 A G 11: 98,593,246 (GRCm39) Y121C probably damaging Het
Csmd3 C T 15: 47,567,505 (GRCm39) probably benign Het
Cyp2c69 A G 19: 39,864,815 (GRCm39) I221T probably benign Het
Dgcr2 T C 16: 17,675,115 (GRCm39) probably benign Het
Dhcr7 T C 7: 143,401,250 (GRCm39) F474S probably damaging Het
Dnah1 T C 14: 31,032,839 (GRCm39) I399V probably null Het
Efcab14 T A 4: 115,610,188 (GRCm39) L183Q probably damaging Het
Evx2 A G 2: 74,489,501 (GRCm39) V88A probably benign Het
Exph5 A G 9: 53,285,109 (GRCm39) N730S probably benign Het
Farsb T A 1: 78,443,620 (GRCm39) K196I probably benign Het
Fbln7 C T 2: 128,735,682 (GRCm39) probably benign Het
Fhdc1 A G 3: 84,356,085 (GRCm39) F453S probably damaging Het
Gast T A 11: 100,227,684 (GRCm39) W89R probably damaging Het
Gata2 A G 6: 88,182,237 (GRCm39) S402G probably benign Het
Gin1 T A 1: 97,720,162 (GRCm39) S386T probably benign Het
Golgb1 A G 16: 36,736,363 (GRCm39) E1870G probably damaging Het
Hivep3 T A 4: 119,954,768 (GRCm39) V1028E possibly damaging Het
Ifi203 G A 1: 173,756,326 (GRCm39) R486* probably null Het
Ifi209 G A 1: 173,468,728 (GRCm39) S186N probably benign Het
Ifih1 C T 2: 62,436,738 (GRCm39) A562T probably damaging Het
Itch T C 2: 155,014,481 (GRCm39) L106S probably damaging Het
Itga4 T A 2: 79,146,050 (GRCm39) probably null Het
Kdm4c A G 4: 74,199,234 (GRCm39) S141G possibly damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klra3 T C 6: 130,307,226 (GRCm39) probably null Het
Lama2 G C 10: 27,084,403 (GRCm39) F922L probably benign Het
Lama2 A T 10: 27,084,402 (GRCm39) S923T probably damaging Het
Llgl1 G A 11: 60,597,873 (GRCm39) V331M probably damaging Het
Lrrc30 T C 17: 67,938,676 (GRCm39) *301W probably null Het
Map1lc3b C T 8: 122,320,226 (GRCm39) probably benign Het
Mbd2 A G 18: 70,749,690 (GRCm39) I302V probably benign Het
Med27 A G 2: 29,390,307 (GRCm39) Y78C probably damaging Het
Mei1 C T 15: 81,996,771 (GRCm39) probably null Het
Mideas G A 12: 84,205,124 (GRCm39) probably benign Het
Miga1 T C 3: 151,993,191 (GRCm39) E346G probably damaging Het
Myef2 A G 2: 124,957,363 (GRCm39) S131P probably damaging Het
Myocd T C 11: 65,069,527 (GRCm39) H899R probably benign Het
Ncam1 A G 9: 49,456,556 (GRCm39) probably benign Het
Ngf T A 3: 102,427,513 (GRCm39) N87K possibly damaging Het
Nol10 T A 12: 17,466,709 (GRCm39) probably benign Het
Nrip2 A G 6: 128,385,231 (GRCm39) I221V probably benign Het
Nup205 G A 6: 35,182,366 (GRCm39) G777D probably damaging Het
Or5ac17 A G 16: 59,036,344 (GRCm39) F211L probably benign Het
Or5b96 A G 19: 12,867,047 (GRCm39) V298A probably damaging Het
Or6c1 T A 10: 129,518,081 (GRCm39) T176S probably benign Het
Or7g35 A T 9: 19,496,682 (GRCm39) Q283L probably damaging Het
Or8d6 G T 9: 39,854,251 (GRCm39) D232Y probably benign Het
Oxt A T 2: 130,418,220 (GRCm39) R31W probably damaging Het
Pde4dip A G 3: 97,603,246 (GRCm39) S2248P probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pkp2 T C 16: 16,080,561 (GRCm39) S616P probably damaging Het
Plch2 T C 4: 155,084,540 (GRCm39) Y379C probably damaging Het
Pnpt1 A G 11: 29,104,159 (GRCm39) N540D probably benign Het
Ptpn23 G A 9: 110,220,746 (GRCm39) H255Y possibly damaging Het
Rad21 T C 15: 51,835,703 (GRCm39) N237D probably benign Het
Ryr3 A C 2: 112,582,113 (GRCm39) probably null Het
Sgk1 C A 10: 21,873,007 (GRCm39) probably benign Het
Slc1a5 G T 7: 16,531,464 (GRCm39) A490S probably damaging Het
Slc5a8 T C 10: 88,755,326 (GRCm39) Y478H probably benign Het
Slc5a8 T A 10: 88,755,328 (GRCm39) Y478* probably null Het
Slc9a3 A T 13: 74,311,190 (GRCm39) M562L probably benign Het
Spmip4 A G 6: 50,568,801 (GRCm39) probably benign Het
Thsd7a G A 6: 12,555,714 (GRCm39) R57* probably null Het
Tiam1 T C 16: 89,657,167 (GRCm39) R690G probably damaging Het
Tmem150b A G 7: 4,727,365 (GRCm39) S47P probably damaging Het
Trim39 C T 17: 36,574,832 (GRCm39) R190Q probably damaging Het
Ttc32 A T 12: 9,085,073 (GRCm39) I98L possibly damaging Het
Vps13c A G 9: 67,873,003 (GRCm39) T3304A probably benign Het
Wdr35 A C 12: 9,062,728 (GRCm39) D638A probably damaging Het
Wwc1 G T 11: 35,752,671 (GRCm39) P797T probably benign Het
Zan T A 5: 137,462,780 (GRCm39) T800S unknown Het
Zbbx A G 3: 74,990,926 (GRCm39) probably benign Het
Zup1 T C 10: 33,811,172 (GRCm39) M291V probably damaging Het
Other mutations in Aldh3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Aldh3b1 APN 19 3,968,104 (GRCm39) missense probably benign 0.03
IGL01402:Aldh3b1 APN 19 3,971,205 (GRCm39) missense probably benign 0.01
IGL01404:Aldh3b1 APN 19 3,971,205 (GRCm39) missense probably benign 0.01
IGL01784:Aldh3b1 APN 19 3,971,217 (GRCm39) missense probably benign 0.32
IGL02608:Aldh3b1 APN 19 3,964,061 (GRCm39) missense probably damaging 1.00
IGL03223:Aldh3b1 APN 19 3,965,329 (GRCm39) missense probably damaging 0.98
R0320:Aldh3b1 UTSW 19 3,968,999 (GRCm39) splice site probably benign
R0472:Aldh3b1 UTSW 19 3,964,024 (GRCm39) missense probably damaging 1.00
R0609:Aldh3b1 UTSW 19 3,964,024 (GRCm39) missense probably damaging 1.00
R1272:Aldh3b1 UTSW 19 3,971,746 (GRCm39) missense probably damaging 1.00
R1721:Aldh3b1 UTSW 19 3,971,271 (GRCm39) splice site probably benign
R1868:Aldh3b1 UTSW 19 3,971,271 (GRCm39) splice site probably benign
R1911:Aldh3b1 UTSW 19 3,971,187 (GRCm39) missense probably damaging 0.99
R1912:Aldh3b1 UTSW 19 3,971,187 (GRCm39) missense probably damaging 0.99
R2067:Aldh3b1 UTSW 19 3,971,755 (GRCm39) missense probably benign 0.01
R2913:Aldh3b1 UTSW 19 3,971,275 (GRCm39) splice site probably benign
R4133:Aldh3b1 UTSW 19 3,970,808 (GRCm39) missense probably damaging 1.00
R5129:Aldh3b1 UTSW 19 3,965,336 (GRCm39) missense probably benign 0.01
R7764:Aldh3b1 UTSW 19 3,971,563 (GRCm39) nonsense probably null
R8832:Aldh3b1 UTSW 19 3,964,025 (GRCm39) missense probably damaging 1.00
R8876:Aldh3b1 UTSW 19 3,971,502 (GRCm39) missense probably damaging 1.00
R8931:Aldh3b1 UTSW 19 3,968,803 (GRCm39) missense possibly damaging 0.86
R9024:Aldh3b1 UTSW 19 3,968,155 (GRCm39) missense probably damaging 1.00
R9111:Aldh3b1 UTSW 19 3,971,797 (GRCm39) missense probably damaging 1.00
R9253:Aldh3b1 UTSW 19 3,965,315 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGTGTGCTCAGGCCAACTTC -3'
(R):5'- TATGTGGATGACAACTGCGACCCC -3'

Sequencing Primer
(F):5'- CAGGCCAACTTCCAGAGGTATG -3'
(R):5'- TGCGACCCCCAGATAGTG -3'
Posted On 2014-05-23