Incidental Mutation 'R1756:Unc80'
ID 194820
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C230061B10Rik, C030018G13Rik
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.891) question?
Stock # R1756 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 66507526-66738307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66678407 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2063 (T2063A)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: T2063A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: T2063A

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212557
AA Change: T1995A
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 100,148,514 (GRCm39) noncoding transcript Het
Acin1 A G 14: 54,902,661 (GRCm39) V377A probably benign Het
Adam39 A T 8: 41,278,361 (GRCm39) I251F probably damaging Het
Adnp2 A T 18: 80,170,912 (GRCm39) *1166K probably null Het
Akap12 T A 10: 4,307,574 (GRCm39) D1461E probably benign Het
Aopep T A 13: 63,215,875 (GRCm39) H382Q possibly damaging Het
Apba1 A G 19: 23,871,056 (GRCm39) D296G possibly damaging Het
Apol7a G T 15: 77,277,671 (GRCm39) L26M possibly damaging Het
Bcl2 C T 1: 106,640,122 (GRCm39) M163I probably damaging Het
Cap2 T G 13: 46,684,489 (GRCm39) I53R probably benign Het
Ccdc74a T C 16: 17,468,332 (GRCm39) V318A possibly damaging Het
Ccnb2 A G 9: 70,318,070 (GRCm39) V234A probably benign Het
Cd207 C T 6: 83,652,579 (GRCm39) V184I probably benign Het
Cdk12 C A 11: 98,132,587 (GRCm39) C1005* probably null Het
Cep83 T C 10: 94,586,129 (GRCm39) S344P probably damaging Het
Ces1g A T 8: 94,033,582 (GRCm39) Y447N probably benign Het
Cfap54 A T 10: 92,883,923 (GRCm39) L277Q probably damaging Het
Cfh A G 1: 140,028,615 (GRCm39) Y1027H probably damaging Het
Clcnkb T A 4: 141,142,525 (GRCm39) I28F possibly damaging Het
Clec4d A G 6: 123,244,068 (GRCm39) D59G probably damaging Het
Colq G A 14: 31,269,409 (GRCm39) P153S probably damaging Het
Crybg1 T A 10: 43,862,275 (GRCm39) T1500S probably damaging Het
Cyp2d34 T A 15: 82,501,725 (GRCm39) R262W probably damaging Het
Dennd4b C G 3: 90,178,912 (GRCm39) L559V probably damaging Het
Dhrs1 A G 14: 55,976,766 (GRCm39) V306A probably benign Het
Diaph1 A T 18: 37,987,626 (GRCm39) D1043E possibly damaging Het
Dis3 G T 14: 99,323,539 (GRCm39) D538E probably damaging Het
Dnai2 T G 11: 114,641,206 (GRCm39) S344A probably benign Het
Dner C T 1: 84,423,311 (GRCm39) V431M probably damaging Het
Dnm1l A G 16: 16,160,559 (GRCm39) probably null Het
Eps15 T G 4: 109,170,115 (GRCm39) L139* probably null Het
Fam193a T A 5: 34,623,636 (GRCm39) I55N possibly damaging Het
Gm10308 T A 17: 91,396,385 (GRCm39) Y102* probably null Het
Gm10509 A G 17: 21,909,762 (GRCm39) K30E possibly damaging Het
Gpr155 T C 2: 73,197,921 (GRCm39) M400V probably benign Het
H2-M10.2 T C 17: 36,597,015 (GRCm39) probably benign Het
Heatr1 G T 13: 12,411,341 (GRCm39) A61S probably benign Het
Helb G T 10: 119,930,147 (GRCm39) T744K probably damaging Het
Hmcn1 C A 1: 150,474,781 (GRCm39) W4702L probably damaging Het
Hmcn2 C T 2: 31,286,132 (GRCm39) R2095W probably damaging Het
Igfbp3 G C 11: 7,158,461 (GRCm39) D267E probably damaging Het
Ighmbp2 T A 19: 3,318,669 (GRCm39) H469L probably damaging Het
Kcnj3 A C 2: 55,327,232 (GRCm39) K7T probably damaging Het
Krtap5-5 T G 7: 141,783,358 (GRCm39) K97N unknown Het
Lcor T C 19: 41,547,705 (GRCm39) S430P probably benign Het
Lpin1 A G 12: 16,588,541 (GRCm39) V883A probably damaging Het
Lrp1b T C 2: 41,000,837 (GRCm39) Y2243C probably damaging Het
Lrrc46 G A 11: 96,925,556 (GRCm39) probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mpdz C T 4: 81,225,114 (GRCm39) V1438M possibly damaging Het
Muc21 A T 17: 35,930,131 (GRCm39) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm39) L635* probably null Het
Nipbl T C 15: 8,368,035 (GRCm39) N1202D possibly damaging Het
Nphs1 A G 7: 30,160,959 (GRCm39) D196G probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2b2b A G 13: 21,858,865 (GRCm39) I83T probably benign Het
Or8b42 A T 9: 38,342,291 (GRCm39) I238F probably benign Het
Or8k16 A G 2: 85,520,427 (GRCm39) Y218C probably damaging Het
Pax8 A T 2: 24,325,833 (GRCm39) N350K probably damaging Het
Pik3cd T C 4: 149,743,207 (GRCm39) K298E probably benign Het
Pkd1 C T 17: 24,813,459 (GRCm39) R4000C probably damaging Het
Pkn2 A T 3: 142,516,488 (GRCm39) V546D possibly damaging Het
Plcg2 A G 8: 118,319,447 (GRCm39) K673E probably benign Het
Pld4 T G 12: 112,729,826 (GRCm39) probably null Het
Plek A T 11: 16,942,901 (GRCm39) N130K probably damaging Het
Prune2 G A 19: 17,101,068 (GRCm39) D2191N probably benign Het
Ptgis T C 2: 167,048,723 (GRCm39) Y431C probably damaging Het
Rhbdf2 T C 11: 116,498,092 (GRCm39) S36G probably benign Het
Rtn4ip1 C T 10: 43,786,826 (GRCm39) A178V probably damaging Het
Rxfp1 A G 3: 79,578,188 (GRCm39) S168P probably benign Het
Sec24a A G 11: 51,624,590 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slitrk6 C T 14: 110,987,984 (GRCm39) M574I probably benign Het
Slk T C 19: 47,611,116 (GRCm39) F861L probably damaging Het
Smpd3 C A 8: 106,991,603 (GRCm39) A317S probably benign Het
Spopfm1 A T 3: 94,173,525 (GRCm39) M174L probably benign Het
Spz1 T A 13: 92,711,633 (GRCm39) Q281L probably damaging Het
Syde1 T A 10: 78,422,814 (GRCm39) R519S probably benign Het
Taf4 T C 2: 179,618,324 (GRCm39) H39R unknown Het
Tbx5 A T 5: 119,983,178 (GRCm39) probably null Het
Tektl1 T A 10: 78,583,031 (GRCm39) K451M probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Th G A 7: 142,451,903 (GRCm39) Q19* probably null Het
Tmprss11a T A 5: 86,568,038 (GRCm39) I230F probably damaging Het
Tnfrsf14 T A 4: 155,009,779 (GRCm39) H50L possibly damaging Het
Tpp2 T A 1: 44,017,885 (GRCm39) probably null Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim2 A G 3: 84,098,107 (GRCm39) I398T possibly damaging Het
Trpc5 A T X: 143,264,222 (GRCm39) S212T probably damaging Het
Ttn A G 2: 76,617,678 (GRCm39) probably benign Het
Usp37 A T 1: 74,518,814 (GRCm39) S260T probably benign Het
Vcan A G 13: 89,839,800 (GRCm39) S1915P probably benign Het
Vmn1r33 T A 6: 66,589,282 (GRCm39) I91F possibly damaging Het
Zfp422 T C 6: 116,603,385 (GRCm39) T205A probably benign Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66,693,554 (GRCm39) missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66,645,618 (GRCm39) missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00784:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00935:Unc80 APN 1 66,666,425 (GRCm39) missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66,734,592 (GRCm39) missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66,661,645 (GRCm39) missense probably benign 0.33
IGL01577:Unc80 APN 1 66,569,127 (GRCm39) splice site probably null
IGL01626:Unc80 APN 1 66,590,213 (GRCm39) critical splice donor site probably null
IGL01640:Unc80 APN 1 66,718,744 (GRCm39) missense probably benign 0.33
IGL01775:Unc80 APN 1 66,640,215 (GRCm39) missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66,647,659 (GRCm39) splice site probably benign
IGL01991:Unc80 APN 1 66,508,668 (GRCm39) nonsense probably null
IGL02022:Unc80 APN 1 66,665,675 (GRCm39) missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66,651,386 (GRCm39) missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66,564,875 (GRCm39) missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66,569,224 (GRCm39) missense probably benign 0.39
IGL02198:Unc80 APN 1 66,569,145 (GRCm39) missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66,647,587 (GRCm39) missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66,680,832 (GRCm39) missense probably benign 0.33
IGL02447:Unc80 APN 1 66,542,703 (GRCm39) missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66,564,860 (GRCm39) missense probably benign 0.07
IGL02546:Unc80 APN 1 66,594,112 (GRCm39) missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66,522,476 (GRCm39) missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66,569,222 (GRCm39) missense probably damaging 0.98
IGL02839:Unc80 APN 1 66,710,834 (GRCm39) missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66,717,217 (GRCm39) splice site probably benign
IGL02974:Unc80 APN 1 66,564,817 (GRCm39) missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66,676,169 (GRCm39) missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66,548,648 (GRCm39) missense probably damaging 0.96
IGL03074:Unc80 APN 1 66,710,877 (GRCm39) splice site probably benign
IGL03086:Unc80 APN 1 66,548,633 (GRCm39) missense probably damaging 0.99
IGL03105:Unc80 APN 1 66,511,258 (GRCm39) missense probably damaging 0.96
IGL03107:Unc80 APN 1 66,670,613 (GRCm39) missense probably damaging 0.98
IGL03158:Unc80 APN 1 66,680,833 (GRCm39) missense probably benign 0.33
IGL03220:Unc80 APN 1 66,544,097 (GRCm39) missense probably damaging 0.99
IGL03271:Unc80 APN 1 66,734,762 (GRCm39) unclassified probably benign
IGL03332:Unc80 APN 1 66,542,790 (GRCm39) missense probably damaging 1.00
IGL03347:Unc80 APN 1 66,734,625 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0026:Unc80 UTSW 1 66,560,743 (GRCm39) missense probably benign 0.27
R0055:Unc80 UTSW 1 66,545,782 (GRCm39) splice site probably benign
R0149:Unc80 UTSW 1 66,560,760 (GRCm39) missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66,550,040 (GRCm39) missense probably damaging 1.00
R0329:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66,589,015 (GRCm39) missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66,590,096 (GRCm39) splice site probably benign
R0422:Unc80 UTSW 1 66,522,497 (GRCm39) missense probably damaging 1.00
R0477:Unc80 UTSW 1 66,609,160 (GRCm39) missense probably damaging 0.99
R0507:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66,661,633 (GRCm39) missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66,545,828 (GRCm39) missense probably damaging 0.97
R0626:Unc80 UTSW 1 66,647,601 (GRCm39) missense probably benign 0.01
R0655:Unc80 UTSW 1 66,542,940 (GRCm39) missense probably damaging 0.98
R0742:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66,544,082 (GRCm39) missense probably damaging 1.00
R0782:Unc80 UTSW 1 66,661,740 (GRCm39) missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66,688,103 (GRCm39) missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R0893:Unc80 UTSW 1 66,560,645 (GRCm39) missense probably damaging 0.97
R0900:Unc80 UTSW 1 66,710,757 (GRCm39) missense probably benign 0.33
R0924:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66,685,599 (GRCm39) missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1224:Unc80 UTSW 1 66,511,139 (GRCm39) missense probably damaging 1.00
R1240:Unc80 UTSW 1 66,675,061 (GRCm39) missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66,594,254 (GRCm39) missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66,677,116 (GRCm39) missense probably damaging 1.00
R1655:Unc80 UTSW 1 66,711,915 (GRCm39) missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66,548,467 (GRCm39) missense probably damaging 1.00
R1680:Unc80 UTSW 1 66,542,828 (GRCm39) nonsense probably null
R1739:Unc80 UTSW 1 66,567,051 (GRCm39) missense probably damaging 0.97
R1783:Unc80 UTSW 1 66,722,432 (GRCm39) missense probably benign 0.01
R1834:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66,670,573 (GRCm39) missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66,549,876 (GRCm39) missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66,548,561 (GRCm39) missense probably damaging 0.96
R1883:Unc80 UTSW 1 66,564,929 (GRCm39) missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66,549,784 (GRCm39) missense probably damaging 1.00
R1990:Unc80 UTSW 1 66,731,708 (GRCm39) missense probably damaging 0.97
R2007:Unc80 UTSW 1 66,542,935 (GRCm39) missense probably damaging 1.00
R2035:Unc80 UTSW 1 66,645,752 (GRCm39) missense probably damaging 0.98
R2056:Unc80 UTSW 1 66,679,711 (GRCm39) missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66,679,754 (GRCm39) missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66,718,903 (GRCm39) critical splice donor site probably null
R2088:Unc80 UTSW 1 66,629,386 (GRCm39) missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2091:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2139:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66,716,514 (GRCm39) missense probably damaging 1.00
R2248:Unc80 UTSW 1 66,662,365 (GRCm39) splice site probably benign
R2255:Unc80 UTSW 1 66,657,417 (GRCm39) missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66,688,156 (GRCm39) missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66,651,266 (GRCm39) missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66,710,767 (GRCm39) missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66,710,735 (GRCm39) critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3104:Unc80 UTSW 1 66,662,450 (GRCm39) missense probably benign 0.33
R3402:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3403:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3413:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3426:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3427:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3428:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3904:Unc80 UTSW 1 66,678,455 (GRCm39) nonsense probably null
R3916:Unc80 UTSW 1 66,716,654 (GRCm39) missense probably benign 0.11
R3950:Unc80 UTSW 1 66,661,729 (GRCm39) missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66,710,873 (GRCm39) splice site probably null
R4646:Unc80 UTSW 1 66,708,394 (GRCm39) missense probably benign 0.03
R4655:Unc80 UTSW 1 66,710,821 (GRCm39) missense probably benign 0.18
R4662:Unc80 UTSW 1 66,685,595 (GRCm39) missense probably benign 0.01
R4720:Unc80 UTSW 1 66,549,951 (GRCm39) missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66,688,831 (GRCm39) critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66,567,100 (GRCm39) missense probably damaging 0.97
R4888:Unc80 UTSW 1 66,683,606 (GRCm39) missense probably damaging 0.98
R4917:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66,713,891 (GRCm39) splice site probably null
R5051:Unc80 UTSW 1 66,548,636 (GRCm39) missense probably damaging 0.96
R5111:Unc80 UTSW 1 66,567,154 (GRCm39) missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66,718,749 (GRCm39) missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66,685,746 (GRCm39) missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66,645,672 (GRCm39) missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66,569,180 (GRCm39) missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66,693,737 (GRCm39) missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66,645,773 (GRCm39) missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66,677,202 (GRCm39) missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66,679,731 (GRCm39) missense probably benign 0.08
R5762:Unc80 UTSW 1 66,732,955 (GRCm39) missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66,567,123 (GRCm39) missense probably damaging 0.97
R6005:Unc80 UTSW 1 66,666,416 (GRCm39) missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66,734,727 (GRCm39) missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66,714,226 (GRCm39) missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66,651,409 (GRCm39) missense probably benign 0.01
R6157:Unc80 UTSW 1 66,693,188 (GRCm39) nonsense probably null
R6189:Unc80 UTSW 1 66,716,630 (GRCm39) missense probably benign 0.33
R6291:Unc80 UTSW 1 66,560,756 (GRCm39) missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66,711,925 (GRCm39) missense probably benign 0.33
R6598:Unc80 UTSW 1 66,507,699 (GRCm39) critical splice donor site probably null
R6724:Unc80 UTSW 1 66,722,350 (GRCm39) missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66,560,636 (GRCm39) missense probably benign 0.00
R6773:Unc80 UTSW 1 66,690,702 (GRCm39) missense probably benign 0.33
R6883:Unc80 UTSW 1 66,685,563 (GRCm39) missense probably benign 0.33
R6951:Unc80 UTSW 1 66,687,670 (GRCm39) missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66,685,725 (GRCm39) missense probably benign 0.33
R6993:Unc80 UTSW 1 66,588,952 (GRCm39) missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66,542,752 (GRCm39) missense probably benign 0.00
R7050:Unc80 UTSW 1 66,590,067 (GRCm39) splice site probably null
R7067:Unc80 UTSW 1 66,685,731 (GRCm39) missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66,685,680 (GRCm39) missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66,588,943 (GRCm39) missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66,560,725 (GRCm39) nonsense probably null
R7278:Unc80 UTSW 1 66,591,368 (GRCm39) missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66,640,356 (GRCm39) missense probably damaging 0.97
R7391:Unc80 UTSW 1 66,734,687 (GRCm39) missense probably benign 0.18
R7401:Unc80 UTSW 1 66,685,574 (GRCm39) missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66,661,621 (GRCm39) missense probably benign 0.02
R7573:Unc80 UTSW 1 66,560,696 (GRCm39) missense probably damaging 1.00
R7637:Unc80 UTSW 1 66,711,843 (GRCm39) missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66,688,881 (GRCm39) missense probably benign 0.33
R7697:Unc80 UTSW 1 66,677,104 (GRCm39) missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66,716,544 (GRCm39) missense probably benign 0.33
R7768:Unc80 UTSW 1 66,549,754 (GRCm39) missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66,542,873 (GRCm39) missense probably benign
R7855:Unc80 UTSW 1 66,522,508 (GRCm39) missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66,640,300 (GRCm39) missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66,549,866 (GRCm39) missense probably benign 0.00
R8024:Unc80 UTSW 1 66,645,803 (GRCm39) missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66,522,463 (GRCm39) missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66,688,072 (GRCm39) missense probably benign 0.00
R8135:Unc80 UTSW 1 66,548,446 (GRCm39) missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66,690,692 (GRCm39) missense probably benign 0.33
R8239:Unc80 UTSW 1 66,693,178 (GRCm39) missense probably benign
R8249:Unc80 UTSW 1 66,658,650 (GRCm39) missense probably benign 0.01
R8275:Unc80 UTSW 1 66,679,773 (GRCm39) nonsense probably null
R8288:Unc80 UTSW 1 66,512,509 (GRCm39) missense probably benign 0.07
R8341:Unc80 UTSW 1 66,688,192 (GRCm39) missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66,677,187 (GRCm39) nonsense probably null
R8456:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66,512,423 (GRCm39) missense probably damaging 1.00
R8483:Unc80 UTSW 1 66,732,869 (GRCm39) missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66,651,427 (GRCm39) missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66,677,191 (GRCm39) missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66,647,649 (GRCm39) missense probably benign 0.01
R8755:Unc80 UTSW 1 66,651,290 (GRCm39) missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66,685,554 (GRCm39) missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66,629,388 (GRCm39) missense probably benign 0.05
R8877:Unc80 UTSW 1 66,567,144 (GRCm39) missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66,512,468 (GRCm39) missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66,511,169 (GRCm39) missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66,645,816 (GRCm39) critical splice donor site probably null
R9095:Unc80 UTSW 1 66,545,912 (GRCm39) missense probably damaging 1.00
R9125:Unc80 UTSW 1 66,718,740 (GRCm39) missense probably benign 0.18
R9130:Unc80 UTSW 1 66,677,244 (GRCm39) missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66,589,000 (GRCm39) missense probably null 0.95
R9220:Unc80 UTSW 1 66,546,534 (GRCm39) missense probably damaging 1.00
R9262:Unc80 UTSW 1 66,594,411 (GRCm39) intron probably benign
R9334:Unc80 UTSW 1 66,688,919 (GRCm39) missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66,629,460 (GRCm39) missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66,589,097 (GRCm39) critical splice donor site probably null
R9415:Unc80 UTSW 1 66,550,064 (GRCm39) missense
R9427:Unc80 UTSW 1 66,594,158 (GRCm39) missense probably damaging 1.00
R9436:Unc80 UTSW 1 66,732,964 (GRCm39) critical splice donor site probably null
R9454:Unc80 UTSW 1 66,734,749 (GRCm39) missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66,677,221 (GRCm39) missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66,609,163 (GRCm39) critical splice donor site probably null
R9552:Unc80 UTSW 1 66,717,282 (GRCm39) missense possibly damaging 0.85
R9667:Unc80 UTSW 1 66,651,287 (GRCm39) missense possibly damaging 0.86
R9720:Unc80 UTSW 1 66,683,485 (GRCm39) missense possibly damaging 0.53
R9749:Unc80 UTSW 1 66,544,179 (GRCm39) missense probably damaging 0.99
R9789:Unc80 UTSW 1 66,651,371 (GRCm39) missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66,687,541 (GRCm39) missense probably benign 0.33
X0021:Unc80 UTSW 1 66,548,425 (GRCm39) critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66,530,205 (GRCm39) missense probably benign 0.21
X0062:Unc80 UTSW 1 66,662,418 (GRCm39) missense probably benign 0.02
X0066:Unc80 UTSW 1 66,569,916 (GRCm39) missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66,685,610 (GRCm39) missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66,733,568 (GRCm39) missense probably benign
Z1177:Unc80 UTSW 1 66,734,498 (GRCm39) missense probably benign 0.03
Z1177:Unc80 UTSW 1 66,685,557 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACCATTGAACAGGTGGCGTGGATG -3'
(R):5'- AAGGCAGCACTGATGTTTGGGAC -3'

Sequencing Primer
(F):5'- AGCCATATTGGCACTCACATTC -3'
(R):5'- TCAGTTACAACTGGGGGAACTTAC -3'
Posted On 2014-05-23