Incidental Mutation 'R1756:Shf'
ID 194833
Institutional Source Beutler Lab
Gene Symbol Shf
Ensembl Gene ENSMUSG00000033256
Gene Name Src homology 2 domain containing F
Synonyms
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1756 (G1)
Quality Score 115
Status Validated
Chromosome 2
Chromosomal Location 122348892-122369162 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 122368682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 51 (P51S)
Ref Sequence ENSEMBL: ENSMUSP00000106161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000125826]
AlphaFold Q8CG80
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110532
AA Change: P51S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256
AA Change: P51S

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125826
AA Change: P161S

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256
AA Change: P161S

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
AA Change: P152S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 99,421,882 (GRCm38) noncoding transcript Het
Acin1 A G 14: 54,665,204 (GRCm38) V377A probably benign Het
Adam39 A T 8: 40,825,324 (GRCm38) I251F probably damaging Het
Adnp2 A T 18: 80,127,697 (GRCm38) *1166K probably null Het
Akap12 T A 10: 4,357,574 (GRCm38) D1461E probably benign Het
Aopep T A 13: 63,068,061 (GRCm38) H382Q possibly damaging Het
Apba1 A G 19: 23,893,692 (GRCm38) D296G possibly damaging Het
Apol7a G T 15: 77,393,471 (GRCm38) L26M possibly damaging Het
Bcl2 C T 1: 106,712,392 (GRCm38) M163I probably damaging Het
Cap2 T G 13: 46,531,013 (GRCm38) I53R probably benign Het
Ccdc74a T C 16: 17,650,468 (GRCm38) V318A possibly damaging Het
Ccnb2 A G 9: 70,410,788 (GRCm38) V234A probably benign Het
Cd207 C T 6: 83,675,597 (GRCm38) V184I probably benign Het
Cdk12 C A 11: 98,241,761 (GRCm38) C1005* probably null Het
Cep83 T C 10: 94,750,267 (GRCm38) S344P probably damaging Het
Ces1g A T 8: 93,306,954 (GRCm38) Y447N probably benign Het
Cfap54 A T 10: 93,048,061 (GRCm38) L277Q probably damaging Het
Cfh A G 1: 140,100,877 (GRCm38) Y1027H probably damaging Het
Clcnkb T A 4: 141,415,214 (GRCm38) I28F possibly damaging Het
Clec4d A G 6: 123,267,109 (GRCm38) D59G probably damaging Het
Colq G A 14: 31,547,452 (GRCm38) P153S probably damaging Het
Crybg1 T A 10: 43,986,279 (GRCm38) T1500S probably damaging Het
Cyp2d34 T A 15: 82,617,524 (GRCm38) R262W probably damaging Het
Dennd4b C G 3: 90,271,605 (GRCm38) L559V probably damaging Het
Dhrs1 A G 14: 55,739,309 (GRCm38) V306A probably benign Het
Diaph1 A T 18: 37,854,573 (GRCm38) D1043E possibly damaging Het
Dis3 G T 14: 99,086,103 (GRCm38) D538E probably damaging Het
Dnai2 T G 11: 114,750,380 (GRCm38) S344A probably benign Het
Dner C T 1: 84,445,590 (GRCm38) V431M probably damaging Het
Dnm1l A G 16: 16,342,695 (GRCm38) probably null Het
Eps15 T G 4: 109,312,918 (GRCm38) L139* probably null Het
Fam193a T A 5: 34,466,292 (GRCm38) I55N possibly damaging Het
Gm10308 T A 17: 91,088,957 (GRCm38) Y102* probably null Het
Gm10509 A G 17: 21,690,855 (GRCm38) K30E possibly damaging Het
Gpr155 T C 2: 73,367,577 (GRCm38) M400V probably benign Het
H2-M10.2 T C 17: 36,286,123 (GRCm38) probably benign Het
Heatr1 G T 13: 12,396,460 (GRCm38) A61S probably benign Het
Helb G T 10: 120,094,242 (GRCm38) T744K probably damaging Het
Hmcn1 C A 1: 150,599,030 (GRCm38) W4702L probably damaging Het
Hmcn2 C T 2: 31,396,120 (GRCm38) R2095W probably damaging Het
Igfbp3 G C 11: 7,208,461 (GRCm38) D267E probably damaging Het
Ighmbp2 T A 19: 3,268,669 (GRCm38) H469L probably damaging Het
Kcnj3 A C 2: 55,437,220 (GRCm38) K7T probably damaging Het
Krtap5-5 T G 7: 142,229,621 (GRCm38) K97N unknown Het
Lcor T C 19: 41,559,266 (GRCm38) S430P probably benign Het
Lpin1 A G 12: 16,538,540 (GRCm38) V883A probably damaging Het
Lrp1b T C 2: 41,110,825 (GRCm38) Y2243C probably damaging Het
Lrrc46 G A 11: 97,034,730 (GRCm38) probably benign Het
Man1c1 G C 4: 134,703,438 (GRCm38) P11R probably damaging Het
Mpdz C T 4: 81,306,877 (GRCm38) V1438M possibly damaging Het
Muc21 A T 17: 35,619,239 (GRCm38) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm38) L635* probably null Het
Nipbl T C 15: 8,338,551 (GRCm38) N1202D possibly damaging Het
Nphs1 A G 7: 30,461,534 (GRCm38) D196G probably benign Het
Nup58 A T 14: 60,244,670 (GRCm38) probably benign Het
Or2b2b A G 13: 21,674,695 (GRCm38) I83T probably benign Het
Or8b42 A T 9: 38,430,995 (GRCm38) I238F probably benign Het
Or8k16 A G 2: 85,690,083 (GRCm38) Y218C probably damaging Het
Pax8 A T 2: 24,435,821 (GRCm38) N350K probably damaging Het
Pik3cd T C 4: 149,658,750 (GRCm38) K298E probably benign Het
Pkd1 C T 17: 24,594,485 (GRCm38) R4000C probably damaging Het
Pkn2 A T 3: 142,810,727 (GRCm38) V546D possibly damaging Het
Plcg2 A G 8: 117,592,708 (GRCm38) K673E probably benign Het
Pld4 T G 12: 112,763,392 (GRCm38) probably null Het
Plek A T 11: 16,992,901 (GRCm38) N130K probably damaging Het
Prune2 G A 19: 17,123,704 (GRCm38) D2191N probably benign Het
Ptgis T C 2: 167,206,803 (GRCm38) Y431C probably damaging Het
Rhbdf2 T C 11: 116,607,266 (GRCm38) S36G probably benign Het
Rtn4ip1 C T 10: 43,910,830 (GRCm38) A178V probably damaging Het
Rxfp1 A G 3: 79,670,881 (GRCm38) S168P probably benign Het
Sec24a A G 11: 51,733,763 (GRCm38) probably benign Het
Slitrk6 C T 14: 110,750,552 (GRCm38) M574I probably benign Het
Slk T C 19: 47,622,677 (GRCm38) F861L probably damaging Het
Smpd3 C A 8: 106,264,971 (GRCm38) A317S probably benign Het
Spopfm1 A T 3: 94,266,218 (GRCm38) M174L probably benign Het
Spz1 T A 13: 92,575,125 (GRCm38) Q281L probably damaging Het
Syde1 T A 10: 78,586,980 (GRCm38) R519S probably benign Het
Taf4 T C 2: 179,976,531 (GRCm38) H39R unknown Het
Tbx5 A T 5: 119,845,113 (GRCm38) probably null Het
Tektl1 T A 10: 78,747,197 (GRCm38) K451M probably damaging Het
Tenm2 C T 11: 36,063,177 (GRCm38) G1236R possibly damaging Het
Th G A 7: 142,898,166 (GRCm38) Q19* probably null Het
Tmprss11a T A 5: 86,420,179 (GRCm38) I230F probably damaging Het
Tnfrsf14 T A 4: 154,925,322 (GRCm38) H50L possibly damaging Het
Tpp2 T A 1: 43,978,725 (GRCm38) probably null Het
Trappc9 G A 15: 73,025,967 (GRCm38) R377W probably damaging Het
Trim2 A G 3: 84,190,800 (GRCm38) I398T possibly damaging Het
Trpc5 A T X: 144,481,226 (GRCm38) S212T probably damaging Het
Ttn A G 2: 76,787,334 (GRCm38) probably benign Het
Unc80 A G 1: 66,639,248 (GRCm38) T2063A possibly damaging Het
Usp37 A T 1: 74,479,655 (GRCm38) S260T probably benign Het
Vcan A G 13: 89,691,681 (GRCm38) S1915P probably benign Het
Vmn1r33 T A 6: 66,612,298 (GRCm38) I91F possibly damaging Het
Zfp422 T C 6: 116,626,424 (GRCm38) T205A probably benign Het
Other mutations in Shf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Shf APN 2 122,359,488 (GRCm38) missense probably damaging 1.00
FR4589:Shf UTSW 2 122,354,177 (GRCm38) small insertion probably benign
R0624:Shf UTSW 2 122,368,635 (GRCm38) splice site probably benign
R0993:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1180:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1181:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1193:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1194:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1195:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1195:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1257:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1258:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1260:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1267:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1268:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1269:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1270:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1271:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1273:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1388:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1448:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1494:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1615:Shf UTSW 2 122,349,432 (GRCm38) missense probably damaging 1.00
R1697:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1820:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R1950:Shf UTSW 2 122,368,682 (GRCm38) missense probably damaging 0.96
R3732:Shf UTSW 2 122,345,207 (GRCm38) unclassified probably benign
R6794:Shf UTSW 2 122,353,840 (GRCm38) missense probably damaging 1.00
R7414:Shf UTSW 2 122,359,582 (GRCm38) missense possibly damaging 0.50
R8230:Shf UTSW 2 122,349,487 (GRCm38) missense probably damaging 1.00
R8970:Shf UTSW 2 122,357,173 (GRCm38) missense probably benign 0.01
R8997:Shf UTSW 2 122,357,247 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAACAGGAAACAGGGCAGAGTT -3'
(R):5'- CAGCGGTGGAGTCGCAAAGT -3'

Sequencing Primer
(F):5'- GGTTAAAATTTGAGCCCCCG -3'
(R):5'- GAGCACCTGGGCTTTCG -3'
Posted On 2014-05-23