Mutagenetix > Incidental Mutation

Incidental Mutation 'R1756:Ptgis'

194834

Institutional Source

Beutler Lab

Gene Symbol

Ptgis

Ensembl Gene

ENSMUSG00000017969

Gene Name

prostaglandin I2 (prostacyclin) synthase

Synonyms

Cyp8a1, Pgis, Pgi2

MMRRC Submission

039788-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1756 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

167191805-167240604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 167206803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 431 (Y431C)

Ref Sequence

ENSEMBL: ENSMUSP00000085357 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018113] [ENSMUST00000088041]

AlphaFold

O35074

Predicted Effect

probably damaging
Transcript: ENSMUST00000018113
AA Change: Y431C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018113
Gene: ENSMUSG00000017969
AA Change: Y431C

Domain	Start	End	E-Value	Type
low complexity region	4	27	N/A	INTRINSIC
Pfam:p450	31	495	8.6e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000088041
AA Change: Y431C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969
AA Change: Y431C

Domain	Start	End	E-Value	Type
low complexity region	4	27	N/A	INTRINSIC
Pfam:p450	31	496	1.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136271

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143645

Meta Mutation Damage Score

0.7729

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood urea nitrogen and creatinine levels, thickening of the aorta with age, mildly increased blood pressure, and kidney abnormalities including cysts, fibrosis, necrosis, and renal vascular congestion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,068,061	H382Q	possibly damaging	Het
A330008L17Rik	C	A	8: 99,421,882		noncoding transcript	Het
Acin1	A	G	14: 54,665,204	V377A	probably benign	Het
Adam39	A	T	8: 40,825,324	I251F	probably damaging	Het
Adnp2	A	T	18: 80,127,697	*1166K	probably null	Het
Akap12	T	A	10: 4,357,574	D1461E	probably benign	Het
Apba1	A	G	19: 23,893,692	D296G	possibly damaging	Het
Apol7a	G	T	15: 77,393,471	L26M	possibly damaging	Het
Bcl2	C	T	1: 106,712,392	M163I	probably damaging	Het
Cap2	T	G	13: 46,531,013	I53R	probably benign	Het
Ccdc105	T	A	10: 78,747,197	K451M	probably damaging	Het
Ccdc74a	T	C	16: 17,650,468	V318A	possibly damaging	Het
Ccnb2	A	G	9: 70,410,788	V234A	probably benign	Het
Cd207	C	T	6: 83,675,597	V184I	probably benign	Het
Cdk12	C	A	11: 98,241,761	C1005*	probably null	Het
Cep83	T	C	10: 94,750,267	S344P	probably damaging	Het
Ces1g	A	T	8: 93,306,954	Y447N	probably benign	Het
Cfap54	A	T	10: 93,048,061	L277Q	probably damaging	Het
Cfh	A	G	1: 140,100,877	Y1027H	probably damaging	Het
Clcnkb	T	A	4: 141,415,214	I28F	possibly damaging	Het
Clec4d	A	G	6: 123,267,109	D59G	probably damaging	Het
Colq	G	A	14: 31,547,452	P153S	probably damaging	Het
Crybg1	T	A	10: 43,986,279	T1500S	probably damaging	Het
Cyp2d34	T	A	15: 82,617,524	R262W	probably damaging	Het
Dennd4b	C	G	3: 90,271,605	L559V	probably damaging	Het
Dhrs1	A	G	14: 55,739,309	V306A	probably benign	Het
Diaph1	A	T	18: 37,854,573	D1043E	possibly damaging	Het
Dis3	G	T	14: 99,086,103	D538E	probably damaging	Het
Dnaic2	T	G	11: 114,750,380	S344A	probably benign	Het
Dner	C	T	1: 84,445,590	V431M	probably damaging	Het
Dnm1l	A	G	16: 16,342,695		probably null	Het
Eps15	T	G	4: 109,312,918	L139*	probably null	Het
Fam193a	T	A	5: 34,466,292	I55N	possibly damaging	Het
Gm10308	T	A	17: 91,088,957	Y102*	probably null	Het
Gm10509	A	G	17: 21,690,855	K30E	possibly damaging	Het
Gm4778	A	T	3: 94,266,218	M174L	probably benign	Het
Gm9573	A	T	17: 35,619,239		probably benign	Het
Gpr155	T	C	2: 73,367,577	M400V	probably benign	Het
H2-M10.2	T	C	17: 36,286,123		probably benign	Het
Heatr1	G	T	13: 12,396,460	A61S	probably benign	Het
Helb	G	T	10: 120,094,242	T744K	probably damaging	Het
Hmcn1	C	A	1: 150,599,030	W4702L	probably damaging	Het
Hmcn2	C	T	2: 31,396,120	R2095W	probably damaging	Het
Igfbp3	G	C	11: 7,208,461	D267E	probably damaging	Het
Ighmbp2	T	A	19: 3,268,669	H469L	probably damaging	Het
Kcnj3	A	C	2: 55,437,220	K7T	probably damaging	Het
Krtap5-5	T	G	7: 142,229,621	K97N	unknown	Het
Lcor	T	C	19: 41,559,266	S430P	probably benign	Het
Lpin1	A	G	12: 16,538,540	V883A	probably damaging	Het
Lrp1b	T	C	2: 41,110,825	Y2243C	probably damaging	Het
Lrrc46	G	A	11: 97,034,730		probably benign	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Ncbp1	T	A	4: 46,169,131	L635*	probably null	Het
Nipbl	T	C	15: 8,338,551	N1202D	possibly damaging	Het
Nphs1	A	G	7: 30,461,534	D196G	probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1008	A	G	2: 85,690,083	Y218C	probably damaging	Het
Olfr1360	A	G	13: 21,674,695	I83T	probably benign	Het
Olfr901	A	T	9: 38,430,995	I238F	probably benign	Het
Pax8	A	T	2: 24,435,821	N350K	probably damaging	Het
Pik3cd	T	C	4: 149,658,750	K298E	probably benign	Het
Pkd1	C	T	17: 24,594,485	R4000C	probably damaging	Het
Pkn2	A	T	3: 142,810,727	V546D	possibly damaging	Het
Plcg2	A	G	8: 117,592,708	K673E	probably benign	Het
Pld4	T	G	12: 112,763,392		probably null	Het
Plek	A	T	11: 16,992,901	N130K	probably damaging	Het
Prune2	G	A	19: 17,123,704	D2191N	probably benign	Het
Rhbdf2	T	C	11: 116,607,266	S36G	probably benign	Het
Rtn4ip1	C	T	10: 43,910,830	A178V	probably damaging	Het
Rxfp1	A	G	3: 79,670,881	S168P	probably benign	Het
Sec24a	A	G	11: 51,733,763		probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk6	C	T	14: 110,750,552	M574I	probably benign	Het
Slk	T	C	19: 47,622,677	F861L	probably damaging	Het
Smpd3	C	A	8: 106,264,971	A317S	probably benign	Het
Spz1	T	A	13: 92,575,125	Q281L	probably damaging	Het
Syde1	T	A	10: 78,586,980	R519S	probably benign	Het
Taf4	T	C	2: 179,976,531	H39R	unknown	Het
Tbx5	A	T	5: 119,845,113		probably null	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Th	G	A	7: 142,898,166	Q19*	probably null	Het
Tmprss11a	T	A	5: 86,420,179	I230F	probably damaging	Het
Tnfrsf14	T	A	4: 154,925,322	H50L	possibly damaging	Het
Tpp2	T	A	1: 43,978,725		probably null	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim2	A	G	3: 84,190,800	I398T	possibly damaging	Het
Trpc5	A	T	X: 144,481,226	S212T	probably damaging	Het
Ttn	A	G	2: 76,787,334		probably benign	Het
Unc80	A	G	1: 66,639,248	T2063A	possibly damaging	Het
Usp37	A	T	1: 74,479,655	S260T	probably benign	Het
Vcan	A	G	13: 89,691,681	S1915P	probably benign	Het
Vmn1r33	T	A	6: 66,612,298	I91F	possibly damaging	Het
Zfp422	T	C	6: 116,626,424	T205A	probably benign	Het

Other mutations in Ptgis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01562:Ptgis	APN	2	167206830	missense	probably damaging	1.00
IGL01859:Ptgis	APN	2	167214806	critical splice donor site	probably null
IGL01965:Ptgis	APN	2	167208253	missense	probably benign	0.00
IGL02102:Ptgis	APN	2	167225447	missense	probably damaging	0.99
IGL02296:Ptgis	APN	2	167206737	missense	probably damaging	1.00
IGL02434:Ptgis	APN	2	167240342	critical splice donor site	probably null
PIT4142001:Ptgis	UTSW	2	167206830	missense	probably damaging	1.00
R0332:Ptgis	UTSW	2	167214833	missense	probably damaging	0.99
R0614:Ptgis	UTSW	2	167206882	missense	probably damaging	1.00
R1733:Ptgis	UTSW	2	167191968	unclassified	probably benign
R1779:Ptgis	UTSW	2	167214858	missense	probably benign	0.01
R2004:Ptgis	UTSW	2	167214849	missense	possibly damaging	0.94
R2019:Ptgis	UTSW	2	167208279	missense	probably damaging	1.00
R2019:Ptgis	UTSW	2	167214810	nonsense	probably null
R2512:Ptgis	UTSW	2	167207276	missense	probably damaging	0.99
R2679:Ptgis	UTSW	2	167208193	missense	probably benign	0.38
R4962:Ptgis	UTSW	2	167225274	critical splice donor site	probably null
R5174:Ptgis	UTSW	2	167203470	critical splice acceptor site	probably null
R5471:Ptgis	UTSW	2	167224119	missense	probably benign	0.03
R5717:Ptgis	UTSW	2	167208364	splice site	probably benign
R7268:Ptgis	UTSW	2	167206756	missense	probably benign	0.10
R7513:Ptgis	UTSW	2	167225283	missense	probably benign	0.00
R7515:Ptgis	UTSW	2	167206838	missense	possibly damaging	0.91
R7615:Ptgis	UTSW	2	167223988	missense	probably damaging	1.00
R7736:Ptgis	UTSW	2	167191971	missense	unknown
R7891:Ptgis	UTSW	2	167227514	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAACAGTAGAGGCATCAGGTGTCC -3'
(R):5'- TTAGTCAGCCCTGAGTGGTAACCC -3'

Sequencing Primer
(F):5'- TGCTCCAGTCATAACTCACTAATGG -3'
(R):5'- GTAACCCCCTGAGTGGTAAC -3'

Posted On

2014-05-23