Mutagenetix > Incidental Mutations

Incidental Mutation 'R1756:Rxfp1'

194836

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

Lgr7, LOC381489

MMRRC Submission

039788-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R1756 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79641611-79737880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79670881 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 168 (S168P)

Ref Sequence

ENSEMBL: ENSMUSP00000077611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

Predicted Effect

probably benign
Transcript: ENSMUST00000078527
AA Change: S168P

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: S168P

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182345

Predicted Effect

probably benign
Transcript: ENSMUST00000182491

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183040

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,068,061	H382Q	possibly damaging	Het
A330008L17Rik	C	A	8: 99,421,882		noncoding transcript	Het
Acin1	A	G	14: 54,665,204	V377A	probably benign	Het
Adam39	A	T	8: 40,825,324	I251F	probably damaging	Het
Adnp2	A	T	18: 80,127,697	*1166K	probably null	Het
Akap12	T	A	10: 4,357,574	D1461E	probably benign	Het
Apba1	A	G	19: 23,893,692	D296G	possibly damaging	Het
Apol7a	G	T	15: 77,393,471	L26M	possibly damaging	Het
Bcl2	C	T	1: 106,712,392	M163I	probably damaging	Het
Cap2	T	G	13: 46,531,013	I53R	probably benign	Het
Ccdc105	T	A	10: 78,747,197	K451M	probably damaging	Het
Ccdc74a	T	C	16: 17,650,468	V318A	possibly damaging	Het
Ccnb2	A	G	9: 70,410,788	V234A	probably benign	Het
Cd207	C	T	6: 83,675,597	V184I	probably benign	Het
Cdk12	C	A	11: 98,241,761	C1005*	probably null	Het
Cep83	T	C	10: 94,750,267	S344P	probably damaging	Het
Ces1g	A	T	8: 93,306,954	Y447N	probably benign	Het
Cfap54	A	T	10: 93,048,061	L277Q	probably damaging	Het
Cfh	A	G	1: 140,100,877	Y1027H	probably damaging	Het
Clcnkb	T	A	4: 141,415,214	I28F	possibly damaging	Het
Clec4d	A	G	6: 123,267,109	D59G	probably damaging	Het
Colq	G	A	14: 31,547,452	P153S	probably damaging	Het
Crybg1	T	A	10: 43,986,279	T1500S	probably damaging	Het
Cyp2d34	T	A	15: 82,617,524	R262W	probably damaging	Het
Dennd4b	C	G	3: 90,271,605	L559V	probably damaging	Het
Dhrs1	A	G	14: 55,739,309	V306A	probably benign	Het
Diaph1	A	T	18: 37,854,573	D1043E	possibly damaging	Het
Dis3	G	T	14: 99,086,103	D538E	probably damaging	Het
Dnaic2	T	G	11: 114,750,380	S344A	probably benign	Het
Dner	C	T	1: 84,445,590	V431M	probably damaging	Het
Dnm1l	A	G	16: 16,342,695		probably null	Het
Eps15	T	G	4: 109,312,918	L139*	probably null	Het
Fam193a	T	A	5: 34,466,292	I55N	possibly damaging	Het
Gm10308	T	A	17: 91,088,957	Y102*	probably null	Het
Gm10509	A	G	17: 21,690,855	K30E	possibly damaging	Het
Gm4778	A	T	3: 94,266,218	M174L	probably benign	Het
Gm9573	A	T	17: 35,619,239		probably benign	Het
Gpr155	T	C	2: 73,367,577	M400V	probably benign	Het
H2-M10.2	T	C	17: 36,286,123		probably benign	Het
Heatr1	G	T	13: 12,396,460	A61S	probably benign	Het
Helb	G	T	10: 120,094,242	T744K	probably damaging	Het
Hmcn1	C	A	1: 150,599,030	W4702L	probably damaging	Het
Hmcn2	C	T	2: 31,396,120	R2095W	probably damaging	Het
Igfbp3	G	C	11: 7,208,461	D267E	probably damaging	Het
Ighmbp2	T	A	19: 3,268,669	H469L	probably damaging	Het
Kcnj3	A	C	2: 55,437,220	K7T	probably damaging	Het
Krtap5-5	T	G	7: 142,229,621	K97N	unknown	Het
Lcor	T	C	19: 41,559,266	S430P	probably benign	Het
Lpin1	A	G	12: 16,538,540	V883A	probably damaging	Het
Lrp1b	T	C	2: 41,110,825	Y2243C	probably damaging	Het
Lrrc46	G	A	11: 97,034,730		probably benign	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Ncbp1	T	A	4: 46,169,131	L635*	probably null	Het
Nipbl	T	C	15: 8,338,551	N1202D	possibly damaging	Het
Nphs1	A	G	7: 30,461,534	D196G	probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1008	A	G	2: 85,690,083	Y218C	probably damaging	Het
Olfr1360	A	G	13: 21,674,695	I83T	probably benign	Het
Olfr901	A	T	9: 38,430,995	I238F	probably benign	Het
Pax8	A	T	2: 24,435,821	N350K	probably damaging	Het
Pik3cd	T	C	4: 149,658,750	K298E	probably benign	Het
Pkd1	C	T	17: 24,594,485	R4000C	probably damaging	Het
Pkn2	A	T	3: 142,810,727	V546D	possibly damaging	Het
Plcg2	A	G	8: 117,592,708	K673E	probably benign	Het
Pld4	T	G	12: 112,763,392		probably null	Het
Plek	A	T	11: 16,992,901	N130K	probably damaging	Het
Prune2	G	A	19: 17,123,704	D2191N	probably benign	Het
Ptgis	T	C	2: 167,206,803	Y431C	probably damaging	Het
Rhbdf2	T	C	11: 116,607,266	S36G	probably benign	Het
Rtn4ip1	C	T	10: 43,910,830	A178V	probably damaging	Het
Sec24a	A	G	11: 51,733,763		probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk6	C	T	14: 110,750,552	M574I	probably benign	Het
Slk	T	C	19: 47,622,677	F861L	probably damaging	Het
Smpd3	C	A	8: 106,264,971	A317S	probably benign	Het
Spz1	T	A	13: 92,575,125	Q281L	probably damaging	Het
Syde1	T	A	10: 78,586,980	R519S	probably benign	Het
Taf4	T	C	2: 179,976,531	H39R	unknown	Het
Tbx5	A	T	5: 119,845,113		probably null	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Th	G	A	7: 142,898,166	Q19*	probably null	Het
Tmprss11a	T	A	5: 86,420,179	I230F	probably damaging	Het
Tnfrsf14	T	A	4: 154,925,322	H50L	possibly damaging	Het
Tpp2	T	A	1: 43,978,725		probably null	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim2	A	G	3: 84,190,800	I398T	possibly damaging	Het
Trpc5	A	T	X: 144,481,226	S212T	probably damaging	Het
Ttn	A	G	2: 76,787,334		probably benign	Het
Unc80	A	G	1: 66,639,248	T2063A	possibly damaging	Het
Usp37	A	T	1: 74,479,655	S260T	probably benign	Het
Vcan	A	G	13: 89,691,681	S1915P	probably benign	Het
Vmn1r33	T	A	6: 66,612,298	I91F	possibly damaging	Het
Zfp422	T	C	6: 116,626,424	T205A	probably benign	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79652216	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79686868	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79660078	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79660096	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79650492	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79660120	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79652167	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79670846	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79652226	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79667683	missense	probably benign	0.29
juggler	UTSW	3	79650591	nonsense	probably null
R0123:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79644975	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79682535	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79667654	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79737793	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79652377	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79650731	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79705569	splice site	probably null
R0627:Rxfp1	UTSW	3	79648211	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79663293	splice site	probably null
R1309:Rxfp1	UTSW	3	79663292	splice site	probably null
R1803:Rxfp1	UTSW	3	79737769	missense	probably benign
R2415:Rxfp1	UTSW	3	79663319	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79682471	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79644949	missense	probably damaging	0.99
R4091:Rxfp1	UTSW	3	79644761	missense	probably benign
R4250:Rxfp1	UTSW	3	79652272	missense	probably benign	0.41
R4335:Rxfp1	UTSW	3	79686798	critical splice donor site	probably null
R4447:Rxfp1	UTSW	3	79652127	intron	probably benign
R4607:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4676:Rxfp1	UTSW	3	79705668	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79686868	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79650582	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79644802	missense	probably benign
R5059:Rxfp1	UTSW	3	79663312	missense	probably benign
R5131:Rxfp1	UTSW	3	79652164	splice site	probably null
R5641:Rxfp1	UTSW	3	79686892	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79678747	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79661320	missense	possibly damaging	0.89
R5856:Rxfp1	UTSW	3	79663313	missense	possibly damaging	0.76
R6296:Rxfp1	UTSW	3	79667848	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79648289	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79650591	nonsense	probably null
R7059:Rxfp1	UTSW	3	79652269	missense	probably damaging	1.00
R7530:Rxfp1	UTSW	3	79650461	missense	probably benign	0.18
R7626:Rxfp1	UTSW	3	79648090	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79670907	missense	possibly damaging	0.66
R7951:Rxfp1	UTSW	3	79652375	missense	probably damaging	1.00
R8723:Rxfp1	UTSW	3	79650495	missense	probably benign
R8786:Rxfp1	UTSW	3	79663370	critical splice acceptor site	probably null
R8939:Rxfp1	UTSW	3	79644924	missense	probably damaging	0.99
Z1088:Rxfp1	UTSW	3	79705704	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79652367	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGACATCAAGGCTTAGCTGGAACAC -3'
(R):5'- TTAAGGAGGTTTACCAGCGGTGC -3'

Sequencing Primer
(F):5'- TTAGCTGGAACACAGTGTGCC -3'
(R):5'- CCAGGGACAAGGCTGTTG -3'

Posted On

2014-05-23