Incidental Mutation 'R1756:Spopfm1'
ID 194839
Institutional Source Beutler Lab
Gene Symbol Spopfm1
Ensembl Gene ENSMUSG00000089696
Gene Name speckle-type BTB/POZ protein family member 1
Synonyms Gm4778
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.848) question?
Stock # R1756 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 94171343-94174091 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94173525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 174 (M174L)
Ref Sequence ENSEMBL: ENSMUSP00000123868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098878] [ENSMUST00000159517]
AlphaFold L7N229
Predicted Effect probably benign
Transcript: ENSMUST00000098878
AA Change: M178L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096477
Gene: ENSMUSG00000089696
AA Change: M178L

DomainStartEndE-ValueType
MATH 25 134 6.01e-8 SMART
BTB 192 291 7.66e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159517
AA Change: M174L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123868
Gene: ENSMUSG00000089696
AA Change: M174L

DomainStartEndE-ValueType
MATH 21 130 6.01e-8 SMART
BTB 188 287 7.66e-26 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 100,148,514 (GRCm39) noncoding transcript Het
Acin1 A G 14: 54,902,661 (GRCm39) V377A probably benign Het
Adam39 A T 8: 41,278,361 (GRCm39) I251F probably damaging Het
Adnp2 A T 18: 80,170,912 (GRCm39) *1166K probably null Het
Akap12 T A 10: 4,307,574 (GRCm39) D1461E probably benign Het
Aopep T A 13: 63,215,875 (GRCm39) H382Q possibly damaging Het
Apba1 A G 19: 23,871,056 (GRCm39) D296G possibly damaging Het
Apol7a G T 15: 77,277,671 (GRCm39) L26M possibly damaging Het
Bcl2 C T 1: 106,640,122 (GRCm39) M163I probably damaging Het
Cap2 T G 13: 46,684,489 (GRCm39) I53R probably benign Het
Ccdc74a T C 16: 17,468,332 (GRCm39) V318A possibly damaging Het
Ccnb2 A G 9: 70,318,070 (GRCm39) V234A probably benign Het
Cd207 C T 6: 83,652,579 (GRCm39) V184I probably benign Het
Cdk12 C A 11: 98,132,587 (GRCm39) C1005* probably null Het
Cep83 T C 10: 94,586,129 (GRCm39) S344P probably damaging Het
Ces1g A T 8: 94,033,582 (GRCm39) Y447N probably benign Het
Cfap54 A T 10: 92,883,923 (GRCm39) L277Q probably damaging Het
Cfh A G 1: 140,028,615 (GRCm39) Y1027H probably damaging Het
Clcnkb T A 4: 141,142,525 (GRCm39) I28F possibly damaging Het
Clec4d A G 6: 123,244,068 (GRCm39) D59G probably damaging Het
Colq G A 14: 31,269,409 (GRCm39) P153S probably damaging Het
Crybg1 T A 10: 43,862,275 (GRCm39) T1500S probably damaging Het
Cyp2d34 T A 15: 82,501,725 (GRCm39) R262W probably damaging Het
Dennd4b C G 3: 90,178,912 (GRCm39) L559V probably damaging Het
Dhrs1 A G 14: 55,976,766 (GRCm39) V306A probably benign Het
Diaph1 A T 18: 37,987,626 (GRCm39) D1043E possibly damaging Het
Dis3 G T 14: 99,323,539 (GRCm39) D538E probably damaging Het
Dnai2 T G 11: 114,641,206 (GRCm39) S344A probably benign Het
Dner C T 1: 84,423,311 (GRCm39) V431M probably damaging Het
Dnm1l A G 16: 16,160,559 (GRCm39) probably null Het
Eps15 T G 4: 109,170,115 (GRCm39) L139* probably null Het
Fam193a T A 5: 34,623,636 (GRCm39) I55N possibly damaging Het
Gm10308 T A 17: 91,396,385 (GRCm39) Y102* probably null Het
Gm10509 A G 17: 21,909,762 (GRCm39) K30E possibly damaging Het
Gpr155 T C 2: 73,197,921 (GRCm39) M400V probably benign Het
H2-M10.2 T C 17: 36,597,015 (GRCm39) probably benign Het
Heatr1 G T 13: 12,411,341 (GRCm39) A61S probably benign Het
Helb G T 10: 119,930,147 (GRCm39) T744K probably damaging Het
Hmcn1 C A 1: 150,474,781 (GRCm39) W4702L probably damaging Het
Hmcn2 C T 2: 31,286,132 (GRCm39) R2095W probably damaging Het
Igfbp3 G C 11: 7,158,461 (GRCm39) D267E probably damaging Het
Ighmbp2 T A 19: 3,318,669 (GRCm39) H469L probably damaging Het
Kcnj3 A C 2: 55,327,232 (GRCm39) K7T probably damaging Het
Krtap5-5 T G 7: 141,783,358 (GRCm39) K97N unknown Het
Lcor T C 19: 41,547,705 (GRCm39) S430P probably benign Het
Lpin1 A G 12: 16,588,541 (GRCm39) V883A probably damaging Het
Lrp1b T C 2: 41,000,837 (GRCm39) Y2243C probably damaging Het
Lrrc46 G A 11: 96,925,556 (GRCm39) probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mpdz C T 4: 81,225,114 (GRCm39) V1438M possibly damaging Het
Muc21 A T 17: 35,930,131 (GRCm39) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm39) L635* probably null Het
Nipbl T C 15: 8,368,035 (GRCm39) N1202D possibly damaging Het
Nphs1 A G 7: 30,160,959 (GRCm39) D196G probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2b2b A G 13: 21,858,865 (GRCm39) I83T probably benign Het
Or8b42 A T 9: 38,342,291 (GRCm39) I238F probably benign Het
Or8k16 A G 2: 85,520,427 (GRCm39) Y218C probably damaging Het
Pax8 A T 2: 24,325,833 (GRCm39) N350K probably damaging Het
Pik3cd T C 4: 149,743,207 (GRCm39) K298E probably benign Het
Pkd1 C T 17: 24,813,459 (GRCm39) R4000C probably damaging Het
Pkn2 A T 3: 142,516,488 (GRCm39) V546D possibly damaging Het
Plcg2 A G 8: 118,319,447 (GRCm39) K673E probably benign Het
Pld4 T G 12: 112,729,826 (GRCm39) probably null Het
Plek A T 11: 16,942,901 (GRCm39) N130K probably damaging Het
Prune2 G A 19: 17,101,068 (GRCm39) D2191N probably benign Het
Ptgis T C 2: 167,048,723 (GRCm39) Y431C probably damaging Het
Rhbdf2 T C 11: 116,498,092 (GRCm39) S36G probably benign Het
Rtn4ip1 C T 10: 43,786,826 (GRCm39) A178V probably damaging Het
Rxfp1 A G 3: 79,578,188 (GRCm39) S168P probably benign Het
Sec24a A G 11: 51,624,590 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slitrk6 C T 14: 110,987,984 (GRCm39) M574I probably benign Het
Slk T C 19: 47,611,116 (GRCm39) F861L probably damaging Het
Smpd3 C A 8: 106,991,603 (GRCm39) A317S probably benign Het
Spz1 T A 13: 92,711,633 (GRCm39) Q281L probably damaging Het
Syde1 T A 10: 78,422,814 (GRCm39) R519S probably benign Het
Taf4 T C 2: 179,618,324 (GRCm39) H39R unknown Het
Tbx5 A T 5: 119,983,178 (GRCm39) probably null Het
Tektl1 T A 10: 78,583,031 (GRCm39) K451M probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Th G A 7: 142,451,903 (GRCm39) Q19* probably null Het
Tmprss11a T A 5: 86,568,038 (GRCm39) I230F probably damaging Het
Tnfrsf14 T A 4: 155,009,779 (GRCm39) H50L possibly damaging Het
Tpp2 T A 1: 44,017,885 (GRCm39) probably null Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim2 A G 3: 84,098,107 (GRCm39) I398T possibly damaging Het
Trpc5 A T X: 143,264,222 (GRCm39) S212T probably damaging Het
Ttn A G 2: 76,617,678 (GRCm39) probably benign Het
Unc80 A G 1: 66,678,407 (GRCm39) T2063A possibly damaging Het
Usp37 A T 1: 74,518,814 (GRCm39) S260T probably benign Het
Vcan A G 13: 89,839,800 (GRCm39) S1915P probably benign Het
Vmn1r33 T A 6: 66,589,282 (GRCm39) I91F possibly damaging Het
Zfp422 T C 6: 116,603,385 (GRCm39) T205A probably benign Het
Other mutations in Spopfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Spopfm1 APN 3 94,173,791 (GRCm39) missense probably benign 0.00
IGL02032:Spopfm1 APN 3 94,173,640 (GRCm39) missense probably damaging 1.00
IGL02694:Spopfm1 APN 3 94,173,459 (GRCm39) missense probably benign
IGL03171:Spopfm1 APN 3 94,173,762 (GRCm39) missense probably benign 0.00
R0195:Spopfm1 UTSW 3 94,173,229 (GRCm39) missense possibly damaging 0.79
R0739:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1064:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1149:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1149:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1150:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1152:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1284:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1286:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1287:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1349:Spopfm1 UTSW 3 94,173,435 (GRCm39) missense possibly damaging 0.94
R1358:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1372:Spopfm1 UTSW 3 94,173,435 (GRCm39) missense possibly damaging 0.94
R1383:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1399:Spopfm1 UTSW 3 94,173,102 (GRCm39) missense probably benign 0.17
R1996:Spopfm1 UTSW 3 94,173,018 (GRCm39) missense probably benign 0.00
R2679:Spopfm1 UTSW 3 94,173,217 (GRCm39) missense probably damaging 1.00
R2878:Spopfm1 UTSW 3 94,173,787 (GRCm39) missense possibly damaging 0.69
R5108:Spopfm1 UTSW 3 94,173,142 (GRCm39) missense probably damaging 1.00
R5706:Spopfm1 UTSW 3 94,173,959 (GRCm39) missense possibly damaging 0.91
R6251:Spopfm1 UTSW 3 94,173,208 (GRCm39) missense probably damaging 1.00
R6928:Spopfm1 UTSW 3 94,173,855 (GRCm39) missense probably benign 0.31
R7091:Spopfm1 UTSW 3 94,173,945 (GRCm39) missense probably damaging 1.00
R7264:Spopfm1 UTSW 3 94,173,045 (GRCm39) missense possibly damaging 0.86
R7503:Spopfm1 UTSW 3 94,173,780 (GRCm39) missense probably benign 0.29
R7595:Spopfm1 UTSW 3 94,173,985 (GRCm39) missense probably benign 0.00
R7867:Spopfm1 UTSW 3 94,173,154 (GRCm39) missense probably benign 0.25
R8338:Spopfm1 UTSW 3 94,173,285 (GRCm39) missense possibly damaging 0.83
R8525:Spopfm1 UTSW 3 94,173,862 (GRCm39) missense probably benign 0.33
R9069:Spopfm1 UTSW 3 94,173,153 (GRCm39) missense possibly damaging 0.93
R9239:Spopfm1 UTSW 3 94,173,871 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CGTTACTCCACTGTCAAAAGAGCCC -3'
(R):5'- TGCCTTCCCAGTGTAAATGAAGCC -3'

Sequencing Primer
(F):5'- CACGAAAGTCGTTAGCTTTCAC -3'
(R):5'- GTAAATGAAGCCCATCATCTCCTTG -3'
Posted On 2014-05-23