Incidental Mutation 'R1756:Syde1'
ID 194871
Institutional Source Beutler Lab
Gene Symbol Syde1
Ensembl Gene ENSMUSG00000032714
Gene Name synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms 1200008N06Rik, mSYD1A
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1756 (G1)
Quality Score 174
Status Validated
Chromosome 10
Chromosomal Location 78420337-78427798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78422814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 519 (R519S)
Ref Sequence ENSEMBL: ENSMUSP00000043085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580] [ENSMUST00000105384] [ENSMUST00000218215] [ENSMUST00000218875] [ENSMUST00000218885] [ENSMUST00000220430]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040580
AA Change: R519S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714
AA Change: R519S

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105384
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218670
Predicted Effect probably benign
Transcript: ENSMUST00000218875
Predicted Effect probably benign
Transcript: ENSMUST00000218885
Predicted Effect probably benign
Transcript: ENSMUST00000219588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219971
Predicted Effect probably benign
Transcript: ENSMUST00000220430
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Rho GTPase-activating protein highly expressed in placenta. The encoded protein is involved in cytoskeletal remodeling and trophoblast cell migration. Decreased expression of this gene has been associated with intrauterine growth restriction (IUGR). [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced miniature excitatory postsynaptic current freuqency and docked vesciles in CA1 synpases. Mice homozygous for another allele exhibit reduced embryos and placental weight with abnormal placenta morphology and placental vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 100,148,514 (GRCm39) noncoding transcript Het
Acin1 A G 14: 54,902,661 (GRCm39) V377A probably benign Het
Adam39 A T 8: 41,278,361 (GRCm39) I251F probably damaging Het
Adnp2 A T 18: 80,170,912 (GRCm39) *1166K probably null Het
Akap12 T A 10: 4,307,574 (GRCm39) D1461E probably benign Het
Aopep T A 13: 63,215,875 (GRCm39) H382Q possibly damaging Het
Apba1 A G 19: 23,871,056 (GRCm39) D296G possibly damaging Het
Apol7a G T 15: 77,277,671 (GRCm39) L26M possibly damaging Het
Bcl2 C T 1: 106,640,122 (GRCm39) M163I probably damaging Het
Cap2 T G 13: 46,684,489 (GRCm39) I53R probably benign Het
Ccdc74a T C 16: 17,468,332 (GRCm39) V318A possibly damaging Het
Ccnb2 A G 9: 70,318,070 (GRCm39) V234A probably benign Het
Cd207 C T 6: 83,652,579 (GRCm39) V184I probably benign Het
Cdk12 C A 11: 98,132,587 (GRCm39) C1005* probably null Het
Cep83 T C 10: 94,586,129 (GRCm39) S344P probably damaging Het
Ces1g A T 8: 94,033,582 (GRCm39) Y447N probably benign Het
Cfap54 A T 10: 92,883,923 (GRCm39) L277Q probably damaging Het
Cfh A G 1: 140,028,615 (GRCm39) Y1027H probably damaging Het
Clcnkb T A 4: 141,142,525 (GRCm39) I28F possibly damaging Het
Clec4d A G 6: 123,244,068 (GRCm39) D59G probably damaging Het
Colq G A 14: 31,269,409 (GRCm39) P153S probably damaging Het
Crybg1 T A 10: 43,862,275 (GRCm39) T1500S probably damaging Het
Cyp2d34 T A 15: 82,501,725 (GRCm39) R262W probably damaging Het
Dennd4b C G 3: 90,178,912 (GRCm39) L559V probably damaging Het
Dhrs1 A G 14: 55,976,766 (GRCm39) V306A probably benign Het
Diaph1 A T 18: 37,987,626 (GRCm39) D1043E possibly damaging Het
Dis3 G T 14: 99,323,539 (GRCm39) D538E probably damaging Het
Dnai2 T G 11: 114,641,206 (GRCm39) S344A probably benign Het
Dner C T 1: 84,423,311 (GRCm39) V431M probably damaging Het
Dnm1l A G 16: 16,160,559 (GRCm39) probably null Het
Eps15 T G 4: 109,170,115 (GRCm39) L139* probably null Het
Fam193a T A 5: 34,623,636 (GRCm39) I55N possibly damaging Het
Gm10308 T A 17: 91,396,385 (GRCm39) Y102* probably null Het
Gm10509 A G 17: 21,909,762 (GRCm39) K30E possibly damaging Het
Gpr155 T C 2: 73,197,921 (GRCm39) M400V probably benign Het
H2-M10.2 T C 17: 36,597,015 (GRCm39) probably benign Het
Heatr1 G T 13: 12,411,341 (GRCm39) A61S probably benign Het
Helb G T 10: 119,930,147 (GRCm39) T744K probably damaging Het
Hmcn1 C A 1: 150,474,781 (GRCm39) W4702L probably damaging Het
Hmcn2 C T 2: 31,286,132 (GRCm39) R2095W probably damaging Het
Igfbp3 G C 11: 7,158,461 (GRCm39) D267E probably damaging Het
Ighmbp2 T A 19: 3,318,669 (GRCm39) H469L probably damaging Het
Kcnj3 A C 2: 55,327,232 (GRCm39) K7T probably damaging Het
Krtap5-5 T G 7: 141,783,358 (GRCm39) K97N unknown Het
Lcor T C 19: 41,547,705 (GRCm39) S430P probably benign Het
Lpin1 A G 12: 16,588,541 (GRCm39) V883A probably damaging Het
Lrp1b T C 2: 41,000,837 (GRCm39) Y2243C probably damaging Het
Lrrc46 G A 11: 96,925,556 (GRCm39) probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mpdz C T 4: 81,225,114 (GRCm39) V1438M possibly damaging Het
Muc21 A T 17: 35,930,131 (GRCm39) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm39) L635* probably null Het
Nipbl T C 15: 8,368,035 (GRCm39) N1202D possibly damaging Het
Nphs1 A G 7: 30,160,959 (GRCm39) D196G probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2b2b A G 13: 21,858,865 (GRCm39) I83T probably benign Het
Or8b42 A T 9: 38,342,291 (GRCm39) I238F probably benign Het
Or8k16 A G 2: 85,520,427 (GRCm39) Y218C probably damaging Het
Pax8 A T 2: 24,325,833 (GRCm39) N350K probably damaging Het
Pik3cd T C 4: 149,743,207 (GRCm39) K298E probably benign Het
Pkd1 C T 17: 24,813,459 (GRCm39) R4000C probably damaging Het
Pkn2 A T 3: 142,516,488 (GRCm39) V546D possibly damaging Het
Plcg2 A G 8: 118,319,447 (GRCm39) K673E probably benign Het
Pld4 T G 12: 112,729,826 (GRCm39) probably null Het
Plek A T 11: 16,942,901 (GRCm39) N130K probably damaging Het
Prune2 G A 19: 17,101,068 (GRCm39) D2191N probably benign Het
Ptgis T C 2: 167,048,723 (GRCm39) Y431C probably damaging Het
Rhbdf2 T C 11: 116,498,092 (GRCm39) S36G probably benign Het
Rtn4ip1 C T 10: 43,786,826 (GRCm39) A178V probably damaging Het
Rxfp1 A G 3: 79,578,188 (GRCm39) S168P probably benign Het
Sec24a A G 11: 51,624,590 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slitrk6 C T 14: 110,987,984 (GRCm39) M574I probably benign Het
Slk T C 19: 47,611,116 (GRCm39) F861L probably damaging Het
Smpd3 C A 8: 106,991,603 (GRCm39) A317S probably benign Het
Spopfm1 A T 3: 94,173,525 (GRCm39) M174L probably benign Het
Spz1 T A 13: 92,711,633 (GRCm39) Q281L probably damaging Het
Taf4 T C 2: 179,618,324 (GRCm39) H39R unknown Het
Tbx5 A T 5: 119,983,178 (GRCm39) probably null Het
Tektl1 T A 10: 78,583,031 (GRCm39) K451M probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Th G A 7: 142,451,903 (GRCm39) Q19* probably null Het
Tmprss11a T A 5: 86,568,038 (GRCm39) I230F probably damaging Het
Tnfrsf14 T A 4: 155,009,779 (GRCm39) H50L possibly damaging Het
Tpp2 T A 1: 44,017,885 (GRCm39) probably null Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim2 A G 3: 84,098,107 (GRCm39) I398T possibly damaging Het
Trpc5 A T X: 143,264,222 (GRCm39) S212T probably damaging Het
Ttn A G 2: 76,617,678 (GRCm39) probably benign Het
Unc80 A G 1: 66,678,407 (GRCm39) T2063A possibly damaging Het
Usp37 A T 1: 74,518,814 (GRCm39) S260T probably benign Het
Vcan A G 13: 89,839,800 (GRCm39) S1915P probably benign Het
Vmn1r33 T A 6: 66,589,282 (GRCm39) I91F possibly damaging Het
Zfp422 T C 6: 116,603,385 (GRCm39) T205A probably benign Het
Other mutations in Syde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syde1 APN 10 78,421,643 (GRCm39) missense probably damaging 1.00
IGL01285:Syde1 APN 10 78,424,721 (GRCm39) missense probably damaging 1.00
IGL01529:Syde1 APN 10 78,426,015 (GRCm39) missense probably benign
IGL01869:Syde1 APN 10 78,424,753 (GRCm39) missense possibly damaging 0.93
IGL02098:Syde1 APN 10 78,425,205 (GRCm39) missense probably damaging 1.00
IGL03187:Syde1 APN 10 78,424,943 (GRCm39) missense possibly damaging 0.79
R0014:Syde1 UTSW 10 78,425,868 (GRCm39) missense probably benign
R0561:Syde1 UTSW 10 78,425,210 (GRCm39) missense probably damaging 1.00
R0605:Syde1 UTSW 10 78,424,929 (GRCm39) unclassified probably benign
R1713:Syde1 UTSW 10 78,421,530 (GRCm39) missense probably damaging 1.00
R4491:Syde1 UTSW 10 78,426,062 (GRCm39) missense probably benign 0.00
R4846:Syde1 UTSW 10 78,424,731 (GRCm39) missense probably damaging 0.99
R5092:Syde1 UTSW 10 78,425,252 (GRCm39) missense probably benign
R5287:Syde1 UTSW 10 78,425,871 (GRCm39) missense probably benign
R5611:Syde1 UTSW 10 78,421,725 (GRCm39) missense probably benign
R5951:Syde1 UTSW 10 78,425,150 (GRCm39) missense possibly damaging 0.87
R5957:Syde1 UTSW 10 78,425,951 (GRCm39) missense probably damaging 1.00
R6169:Syde1 UTSW 10 78,421,938 (GRCm39) missense probably damaging 1.00
R7083:Syde1 UTSW 10 78,422,903 (GRCm39) missense probably benign 0.44
R7150:Syde1 UTSW 10 78,422,032 (GRCm39) nonsense probably null
R7239:Syde1 UTSW 10 78,424,615 (GRCm39) missense probably damaging 1.00
R7799:Syde1 UTSW 10 78,425,741 (GRCm39) missense probably benign
R7947:Syde1 UTSW 10 78,425,916 (GRCm39) missense probably damaging 1.00
R8876:Syde1 UTSW 10 78,425,325 (GRCm39) missense probably damaging 1.00
R8946:Syde1 UTSW 10 78,424,683 (GRCm39) missense probably damaging 0.99
R9104:Syde1 UTSW 10 78,421,670 (GRCm39) missense probably benign 0.01
R9132:Syde1 UTSW 10 78,425,340 (GRCm39) missense probably benign
R9703:Syde1 UTSW 10 78,421,557 (GRCm39) missense probably damaging 1.00
R9728:Syde1 UTSW 10 78,424,638 (GRCm39) frame shift probably null
Z1176:Syde1 UTSW 10 78,421,965 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTCCAACCCATGCCGTGTTTG -3'
(R):5'- TTAACCAGAGAGAACCCCTCTGTCC -3'

Sequencing Primer
(F):5'- gcaaatcaccaaactgagcc -3'
(R):5'- TGTCCACAGGCATCCTCAAG -3'
Posted On 2014-05-23