Mutagenetix > Incidental Mutation

Incidental Mutation 'R1756:Cfap54'

194873

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

039788-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R1756 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93048061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 277 (L277Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000020200
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014
AA Change: L277Q

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	643	3e-298	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168110
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: L277Q

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168617
AA Change: L229Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014
AA Change: L229Q

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	148	4.3e-22	PFAM
Pfam:DUF4486	145	595	1.6e-244	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212902
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1675

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

100% (96/96)

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,068,061	H382Q	possibly damaging	Het
A330008L17Rik	C	A	8: 99,421,882		noncoding transcript	Het
Acin1	A	G	14: 54,665,204	V377A	probably benign	Het
Adam39	A	T	8: 40,825,324	I251F	probably damaging	Het
Adnp2	A	T	18: 80,127,697	*1166K	probably null	Het
Akap12	T	A	10: 4,357,574	D1461E	probably benign	Het
Apba1	A	G	19: 23,893,692	D296G	possibly damaging	Het
Apol7a	G	T	15: 77,393,471	L26M	possibly damaging	Het
Bcl2	C	T	1: 106,712,392	M163I	probably damaging	Het
Cap2	T	G	13: 46,531,013	I53R	probably benign	Het
Ccdc105	T	A	10: 78,747,197	K451M	probably damaging	Het
Ccdc74a	T	C	16: 17,650,468	V318A	possibly damaging	Het
Ccnb2	A	G	9: 70,410,788	V234A	probably benign	Het
Cd207	C	T	6: 83,675,597	V184I	probably benign	Het
Cdk12	C	A	11: 98,241,761	C1005*	probably null	Het
Cep83	T	C	10: 94,750,267	S344P	probably damaging	Het
Ces1g	A	T	8: 93,306,954	Y447N	probably benign	Het
Cfh	A	G	1: 140,100,877	Y1027H	probably damaging	Het
Clcnkb	T	A	4: 141,415,214	I28F	possibly damaging	Het
Clec4d	A	G	6: 123,267,109	D59G	probably damaging	Het
Colq	G	A	14: 31,547,452	P153S	probably damaging	Het
Crybg1	T	A	10: 43,986,279	T1500S	probably damaging	Het
Cyp2d34	T	A	15: 82,617,524	R262W	probably damaging	Het
Dennd4b	C	G	3: 90,271,605	L559V	probably damaging	Het
Dhrs1	A	G	14: 55,739,309	V306A	probably benign	Het
Diaph1	A	T	18: 37,854,573	D1043E	possibly damaging	Het
Dis3	G	T	14: 99,086,103	D538E	probably damaging	Het
Dnaic2	T	G	11: 114,750,380	S344A	probably benign	Het
Dner	C	T	1: 84,445,590	V431M	probably damaging	Het
Dnm1l	A	G	16: 16,342,695		probably null	Het
Eps15	T	G	4: 109,312,918	L139*	probably null	Het
Fam193a	T	A	5: 34,466,292	I55N	possibly damaging	Het
Gm10308	T	A	17: 91,088,957	Y102*	probably null	Het
Gm10509	A	G	17: 21,690,855	K30E	possibly damaging	Het
Gm4778	A	T	3: 94,266,218	M174L	probably benign	Het
Gm9573	A	T	17: 35,619,239		probably benign	Het
Gpr155	T	C	2: 73,367,577	M400V	probably benign	Het
H2-M10.2	T	C	17: 36,286,123		probably benign	Het
Heatr1	G	T	13: 12,396,460	A61S	probably benign	Het
Helb	G	T	10: 120,094,242	T744K	probably damaging	Het
Hmcn1	C	A	1: 150,599,030	W4702L	probably damaging	Het
Hmcn2	C	T	2: 31,396,120	R2095W	probably damaging	Het
Igfbp3	G	C	11: 7,208,461	D267E	probably damaging	Het
Ighmbp2	T	A	19: 3,268,669	H469L	probably damaging	Het
Kcnj3	A	C	2: 55,437,220	K7T	probably damaging	Het
Krtap5-5	T	G	7: 142,229,621	K97N	unknown	Het
Lcor	T	C	19: 41,559,266	S430P	probably benign	Het
Lpin1	A	G	12: 16,538,540	V883A	probably damaging	Het
Lrp1b	T	C	2: 41,110,825	Y2243C	probably damaging	Het
Lrrc46	G	A	11: 97,034,730		probably benign	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Ncbp1	T	A	4: 46,169,131	L635*	probably null	Het
Nipbl	T	C	15: 8,338,551	N1202D	possibly damaging	Het
Nphs1	A	G	7: 30,461,534	D196G	probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1008	A	G	2: 85,690,083	Y218C	probably damaging	Het
Olfr1360	A	G	13: 21,674,695	I83T	probably benign	Het
Olfr901	A	T	9: 38,430,995	I238F	probably benign	Het
Pax8	A	T	2: 24,435,821	N350K	probably damaging	Het
Pik3cd	T	C	4: 149,658,750	K298E	probably benign	Het
Pkd1	C	T	17: 24,594,485	R4000C	probably damaging	Het
Pkn2	A	T	3: 142,810,727	V546D	possibly damaging	Het
Plcg2	A	G	8: 117,592,708	K673E	probably benign	Het
Pld4	T	G	12: 112,763,392		probably null	Het
Plek	A	T	11: 16,992,901	N130K	probably damaging	Het
Prune2	G	A	19: 17,123,704	D2191N	probably benign	Het
Ptgis	T	C	2: 167,206,803	Y431C	probably damaging	Het
Rhbdf2	T	C	11: 116,607,266	S36G	probably benign	Het
Rtn4ip1	C	T	10: 43,910,830	A178V	probably damaging	Het
Rxfp1	A	G	3: 79,670,881	S168P	probably benign	Het
Sec24a	A	G	11: 51,733,763		probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk6	C	T	14: 110,750,552	M574I	probably benign	Het
Slk	T	C	19: 47,622,677	F861L	probably damaging	Het
Smpd3	C	A	8: 106,264,971	A317S	probably benign	Het
Spz1	T	A	13: 92,575,125	Q281L	probably damaging	Het
Syde1	T	A	10: 78,586,980	R519S	probably benign	Het
Taf4	T	C	2: 179,976,531	H39R	unknown	Het
Tbx5	A	T	5: 119,845,113		probably null	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Th	G	A	7: 142,898,166	Q19*	probably null	Het
Tmprss11a	T	A	5: 86,420,179	I230F	probably damaging	Het
Tnfrsf14	T	A	4: 154,925,322	H50L	possibly damaging	Het
Tpp2	T	A	1: 43,978,725		probably null	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim2	A	G	3: 84,190,800	I398T	possibly damaging	Het
Trpc5	A	T	X: 144,481,226	S212T	probably damaging	Het
Ttn	A	G	2: 76,787,334		probably benign	Het
Unc80	A	G	1: 66,639,248	T2063A	possibly damaging	Het
Usp37	A	T	1: 74,479,655	S260T	probably benign	Het
Vcan	A	G	13: 89,691,681	S1915P	probably benign	Het
Vmn1r33	T	A	6: 66,612,298	I91F	possibly damaging	Het
Zfp422	T	C	6: 116,626,424	T205A	probably benign	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGCCATCCACCTTAGAGAGCC -3'
(R):5'- AGACACTGAGATGTGAATGCAGCC -3'

Sequencing Primer
(F):5'- CACATACCTCCCCGTGGATG -3'
(R):5'- ggagataggctcttggtaagtg -3'

Posted On

2014-05-23