Incidental Mutation 'R1756:Helb'
ID 194875
Institutional Source Beutler Lab
Gene Symbol Helb
Ensembl Gene ENSMUSG00000020228
Gene Name helicase (DNA) B
Synonyms D10Ertd664e
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.241) question?
Stock # R1756 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 119919513-119948892 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 119930147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 744 (T744K)
Ref Sequence ENSEMBL: ENSMUSP00000020449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000154501]
AlphaFold Q6NVF4
Predicted Effect probably damaging
Transcript: ENSMUST00000020449
AA Change: T744K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228
AA Change: T744K

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 661 4.8e-24 PFAM
Pfam:UvrD_C_2 855 901 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148241
Predicted Effect probably benign
Transcript: ENSMUST00000154501
SMART Domains Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 546 1.2e-8 PFAM
Meta Mutation Damage Score 0.1996 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 100,148,514 (GRCm39) noncoding transcript Het
Acin1 A G 14: 54,902,661 (GRCm39) V377A probably benign Het
Adam39 A T 8: 41,278,361 (GRCm39) I251F probably damaging Het
Adnp2 A T 18: 80,170,912 (GRCm39) *1166K probably null Het
Akap12 T A 10: 4,307,574 (GRCm39) D1461E probably benign Het
Aopep T A 13: 63,215,875 (GRCm39) H382Q possibly damaging Het
Apba1 A G 19: 23,871,056 (GRCm39) D296G possibly damaging Het
Apol7a G T 15: 77,277,671 (GRCm39) L26M possibly damaging Het
Bcl2 C T 1: 106,640,122 (GRCm39) M163I probably damaging Het
Cap2 T G 13: 46,684,489 (GRCm39) I53R probably benign Het
Ccdc74a T C 16: 17,468,332 (GRCm39) V318A possibly damaging Het
Ccnb2 A G 9: 70,318,070 (GRCm39) V234A probably benign Het
Cd207 C T 6: 83,652,579 (GRCm39) V184I probably benign Het
Cdk12 C A 11: 98,132,587 (GRCm39) C1005* probably null Het
Cep83 T C 10: 94,586,129 (GRCm39) S344P probably damaging Het
Ces1g A T 8: 94,033,582 (GRCm39) Y447N probably benign Het
Cfap54 A T 10: 92,883,923 (GRCm39) L277Q probably damaging Het
Cfh A G 1: 140,028,615 (GRCm39) Y1027H probably damaging Het
Clcnkb T A 4: 141,142,525 (GRCm39) I28F possibly damaging Het
Clec4d A G 6: 123,244,068 (GRCm39) D59G probably damaging Het
Colq G A 14: 31,269,409 (GRCm39) P153S probably damaging Het
Crybg1 T A 10: 43,862,275 (GRCm39) T1500S probably damaging Het
Cyp2d34 T A 15: 82,501,725 (GRCm39) R262W probably damaging Het
Dennd4b C G 3: 90,178,912 (GRCm39) L559V probably damaging Het
Dhrs1 A G 14: 55,976,766 (GRCm39) V306A probably benign Het
Diaph1 A T 18: 37,987,626 (GRCm39) D1043E possibly damaging Het
Dis3 G T 14: 99,323,539 (GRCm39) D538E probably damaging Het
Dnai2 T G 11: 114,641,206 (GRCm39) S344A probably benign Het
Dner C T 1: 84,423,311 (GRCm39) V431M probably damaging Het
Dnm1l A G 16: 16,160,559 (GRCm39) probably null Het
Eps15 T G 4: 109,170,115 (GRCm39) L139* probably null Het
Fam193a T A 5: 34,623,636 (GRCm39) I55N possibly damaging Het
Gm10308 T A 17: 91,396,385 (GRCm39) Y102* probably null Het
Gm10509 A G 17: 21,909,762 (GRCm39) K30E possibly damaging Het
Gpr155 T C 2: 73,197,921 (GRCm39) M400V probably benign Het
H2-M10.2 T C 17: 36,597,015 (GRCm39) probably benign Het
Heatr1 G T 13: 12,411,341 (GRCm39) A61S probably benign Het
Hmcn1 C A 1: 150,474,781 (GRCm39) W4702L probably damaging Het
Hmcn2 C T 2: 31,286,132 (GRCm39) R2095W probably damaging Het
Igfbp3 G C 11: 7,158,461 (GRCm39) D267E probably damaging Het
Ighmbp2 T A 19: 3,318,669 (GRCm39) H469L probably damaging Het
Kcnj3 A C 2: 55,327,232 (GRCm39) K7T probably damaging Het
Krtap5-5 T G 7: 141,783,358 (GRCm39) K97N unknown Het
Lcor T C 19: 41,547,705 (GRCm39) S430P probably benign Het
Lpin1 A G 12: 16,588,541 (GRCm39) V883A probably damaging Het
Lrp1b T C 2: 41,000,837 (GRCm39) Y2243C probably damaging Het
Lrrc46 G A 11: 96,925,556 (GRCm39) probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mpdz C T 4: 81,225,114 (GRCm39) V1438M possibly damaging Het
Muc21 A T 17: 35,930,131 (GRCm39) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm39) L635* probably null Het
Nipbl T C 15: 8,368,035 (GRCm39) N1202D possibly damaging Het
Nphs1 A G 7: 30,160,959 (GRCm39) D196G probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2b2b A G 13: 21,858,865 (GRCm39) I83T probably benign Het
Or8b42 A T 9: 38,342,291 (GRCm39) I238F probably benign Het
Or8k16 A G 2: 85,520,427 (GRCm39) Y218C probably damaging Het
Pax8 A T 2: 24,325,833 (GRCm39) N350K probably damaging Het
Pik3cd T C 4: 149,743,207 (GRCm39) K298E probably benign Het
Pkd1 C T 17: 24,813,459 (GRCm39) R4000C probably damaging Het
Pkn2 A T 3: 142,516,488 (GRCm39) V546D possibly damaging Het
Plcg2 A G 8: 118,319,447 (GRCm39) K673E probably benign Het
Pld4 T G 12: 112,729,826 (GRCm39) probably null Het
Plek A T 11: 16,942,901 (GRCm39) N130K probably damaging Het
Prune2 G A 19: 17,101,068 (GRCm39) D2191N probably benign Het
Ptgis T C 2: 167,048,723 (GRCm39) Y431C probably damaging Het
Rhbdf2 T C 11: 116,498,092 (GRCm39) S36G probably benign Het
Rtn4ip1 C T 10: 43,786,826 (GRCm39) A178V probably damaging Het
Rxfp1 A G 3: 79,578,188 (GRCm39) S168P probably benign Het
Sec24a A G 11: 51,624,590 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slitrk6 C T 14: 110,987,984 (GRCm39) M574I probably benign Het
Slk T C 19: 47,611,116 (GRCm39) F861L probably damaging Het
Smpd3 C A 8: 106,991,603 (GRCm39) A317S probably benign Het
Spopfm1 A T 3: 94,173,525 (GRCm39) M174L probably benign Het
Spz1 T A 13: 92,711,633 (GRCm39) Q281L probably damaging Het
Syde1 T A 10: 78,422,814 (GRCm39) R519S probably benign Het
Taf4 T C 2: 179,618,324 (GRCm39) H39R unknown Het
Tbx5 A T 5: 119,983,178 (GRCm39) probably null Het
Tektl1 T A 10: 78,583,031 (GRCm39) K451M probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Th G A 7: 142,451,903 (GRCm39) Q19* probably null Het
Tmprss11a T A 5: 86,568,038 (GRCm39) I230F probably damaging Het
Tnfrsf14 T A 4: 155,009,779 (GRCm39) H50L possibly damaging Het
Tpp2 T A 1: 44,017,885 (GRCm39) probably null Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim2 A G 3: 84,098,107 (GRCm39) I398T possibly damaging Het
Trpc5 A T X: 143,264,222 (GRCm39) S212T probably damaging Het
Ttn A G 2: 76,617,678 (GRCm39) probably benign Het
Unc80 A G 1: 66,678,407 (GRCm39) T2063A possibly damaging Het
Usp37 A T 1: 74,518,814 (GRCm39) S260T probably benign Het
Vcan A G 13: 89,839,800 (GRCm39) S1915P probably benign Het
Vmn1r33 T A 6: 66,589,282 (GRCm39) I91F possibly damaging Het
Zfp422 T C 6: 116,603,385 (GRCm39) T205A probably benign Het
Other mutations in Helb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Helb APN 10 119,934,150 (GRCm39) missense possibly damaging 0.88
IGL00516:Helb APN 10 119,941,329 (GRCm39) missense probably damaging 1.00
IGL00924:Helb APN 10 119,946,889 (GRCm39) missense probably benign 0.01
IGL00971:Helb APN 10 119,930,168 (GRCm39) missense possibly damaging 0.50
IGL01142:Helb APN 10 119,947,049 (GRCm39) missense probably damaging 1.00
IGL01483:Helb APN 10 119,947,043 (GRCm39) missense probably damaging 1.00
IGL01688:Helb APN 10 119,944,885 (GRCm39) missense probably damaging 0.99
IGL01860:Helb APN 10 119,938,738 (GRCm39) missense probably damaging 0.97
IGL02298:Helb APN 10 119,937,431 (GRCm39) missense probably damaging 1.00
IGL02501:Helb APN 10 119,938,693 (GRCm39) missense possibly damaging 0.96
IGL02554:Helb APN 10 119,925,617 (GRCm39) missense probably damaging 1.00
IGL02810:Helb APN 10 119,927,608 (GRCm39) missense possibly damaging 0.48
IGL02902:Helb APN 10 119,925,390 (GRCm39) missense probably benign 0.00
IGL03405:Helb APN 10 119,925,701 (GRCm39) missense probably damaging 1.00
R0004:Helb UTSW 10 119,944,886 (GRCm39) missense probably damaging 1.00
R0092:Helb UTSW 10 119,925,713 (GRCm39) missense probably damaging 1.00
R0436:Helb UTSW 10 119,930,117 (GRCm39) splice site probably benign
R0850:Helb UTSW 10 119,941,272 (GRCm39) missense probably damaging 1.00
R1423:Helb UTSW 10 119,944,871 (GRCm39) missense probably damaging 0.99
R1663:Helb UTSW 10 119,941,338 (GRCm39) missense probably damaging 1.00
R1812:Helb UTSW 10 119,925,471 (GRCm39) nonsense probably null
R1976:Helb UTSW 10 119,930,168 (GRCm39) missense possibly damaging 0.50
R2049:Helb UTSW 10 119,941,926 (GRCm39) missense possibly damaging 0.74
R2063:Helb UTSW 10 119,941,671 (GRCm39) missense probably benign
R2141:Helb UTSW 10 119,941,926 (GRCm39) missense possibly damaging 0.74
R2180:Helb UTSW 10 119,941,353 (GRCm39) missense probably benign 0.02
R2432:Helb UTSW 10 119,941,442 (GRCm39) missense probably benign 0.01
R3030:Helb UTSW 10 119,925,487 (GRCm39) nonsense probably null
R3874:Helb UTSW 10 119,941,942 (GRCm39) missense probably benign 0.31
R3978:Helb UTSW 10 119,925,530 (GRCm39) missense probably benign
R4731:Helb UTSW 10 119,930,193 (GRCm39) critical splice acceptor site probably null
R4734:Helb UTSW 10 119,920,754 (GRCm39) missense probably benign
R4748:Helb UTSW 10 119,920,754 (GRCm39) missense probably benign
R4749:Helb UTSW 10 119,920,754 (GRCm39) missense probably benign
R4840:Helb UTSW 10 119,920,763 (GRCm39) missense probably benign 0.33
R4977:Helb UTSW 10 119,946,786 (GRCm39) missense probably benign 0.01
R5149:Helb UTSW 10 119,941,648 (GRCm39) missense probably benign 0.39
R5220:Helb UTSW 10 119,937,391 (GRCm39) missense probably damaging 1.00
R5447:Helb UTSW 10 119,938,806 (GRCm39) missense possibly damaging 0.88
R5637:Helb UTSW 10 119,941,353 (GRCm39) missense probably benign 0.02
R5660:Helb UTSW 10 119,946,984 (GRCm39) nonsense probably null
R5663:Helb UTSW 10 119,941,698 (GRCm39) missense possibly damaging 0.61
R5806:Helb UTSW 10 119,928,424 (GRCm39) missense probably damaging 1.00
R5951:Helb UTSW 10 119,927,653 (GRCm39) missense possibly damaging 0.91
R6010:Helb UTSW 10 119,941,788 (GRCm39) missense probably damaging 1.00
R6183:Helb UTSW 10 119,948,903 (GRCm39) splice site probably null
R6578:Helb UTSW 10 119,947,086 (GRCm39) missense probably damaging 1.00
R6642:Helb UTSW 10 119,920,835 (GRCm39) missense probably benign 0.17
R6666:Helb UTSW 10 119,920,856 (GRCm39) missense probably damaging 0.99
R6705:Helb UTSW 10 119,925,716 (GRCm39) splice site probably null
R6746:Helb UTSW 10 119,941,373 (GRCm39) missense probably damaging 1.00
R7114:Helb UTSW 10 119,941,161 (GRCm39) missense probably benign 0.09
R7396:Helb UTSW 10 119,925,476 (GRCm39) missense probably benign
R7422:Helb UTSW 10 119,944,799 (GRCm39) missense probably damaging 1.00
R7508:Helb UTSW 10 119,941,188 (GRCm39) missense probably benign 0.04
R7509:Helb UTSW 10 119,925,719 (GRCm39) missense probably damaging 1.00
R7746:Helb UTSW 10 119,931,007 (GRCm39) missense probably null 1.00
R8058:Helb UTSW 10 119,941,483 (GRCm39) missense probably benign 0.00
R8074:Helb UTSW 10 119,925,321 (GRCm39) missense probably benign 0.00
R8348:Helb UTSW 10 119,938,791 (GRCm39) missense probably damaging 1.00
R8428:Helb UTSW 10 119,927,522 (GRCm39) missense probably damaging 1.00
R8448:Helb UTSW 10 119,938,791 (GRCm39) missense probably damaging 1.00
R8710:Helb UTSW 10 119,941,872 (GRCm39) missense probably damaging 1.00
R8751:Helb UTSW 10 119,925,412 (GRCm39) missense probably benign 0.01
R8815:Helb UTSW 10 119,948,692 (GRCm39) missense possibly damaging 0.71
R8822:Helb UTSW 10 119,941,389 (GRCm39) missense probably benign 0.01
R9031:Helb UTSW 10 119,920,790 (GRCm39) missense possibly damaging 0.62
R9340:Helb UTSW 10 119,928,556 (GRCm39) missense probably damaging 1.00
Z1177:Helb UTSW 10 119,928,595 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACACACAGAGTGGCAGAAATTCTCC -3'
(R):5'- GCTAGAGCCCTCAGTTCAATTCCC -3'

Sequencing Primer
(F):5'- CCACATTGATCTTGAAGAGGCTG -3'
(R):5'- ccctcagttcaattcccagtatc -3'
Posted On 2014-05-23