Incidental Mutation 'R1756:Or2b2b'
ID 194887
Institutional Source Beutler Lab
Gene Symbol Or2b2b
Ensembl Gene ENSMUSG00000108534
Gene Name olfactory receptor family 2 subfamily B member 2B
Synonyms MOR256-10, MOR256-35, GA_x6K02T2QHY8-11561962-11562903, Olfr1360
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R1756 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 21858171-21859150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21858865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 83 (I83T)
Ref Sequence ENSEMBL: ENSMUSP00000149423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077843] [ENSMUST00000079135] [ENSMUST00000205788] [ENSMUST00000216083]
AlphaFold K9J6X0
Predicted Effect probably benign
Transcript: ENSMUST00000077843
AA Change: I83T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077010
Gene: ENSMUSG00000108674
AA Change: I83T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-55 PFAM
Pfam:7tm_1 41 290 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079135
AA Change: I83T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074361
Gene: ENSMUSG00000108534
AA Change: I83T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3e-55 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205788
AA Change: I83T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216083
AA Change: I83T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 100,148,514 (GRCm39) noncoding transcript Het
Acin1 A G 14: 54,902,661 (GRCm39) V377A probably benign Het
Adam39 A T 8: 41,278,361 (GRCm39) I251F probably damaging Het
Adnp2 A T 18: 80,170,912 (GRCm39) *1166K probably null Het
Akap12 T A 10: 4,307,574 (GRCm39) D1461E probably benign Het
Aopep T A 13: 63,215,875 (GRCm39) H382Q possibly damaging Het
Apba1 A G 19: 23,871,056 (GRCm39) D296G possibly damaging Het
Apol7a G T 15: 77,277,671 (GRCm39) L26M possibly damaging Het
Bcl2 C T 1: 106,640,122 (GRCm39) M163I probably damaging Het
Cap2 T G 13: 46,684,489 (GRCm39) I53R probably benign Het
Ccdc74a T C 16: 17,468,332 (GRCm39) V318A possibly damaging Het
Ccnb2 A G 9: 70,318,070 (GRCm39) V234A probably benign Het
Cd207 C T 6: 83,652,579 (GRCm39) V184I probably benign Het
Cdk12 C A 11: 98,132,587 (GRCm39) C1005* probably null Het
Cep83 T C 10: 94,586,129 (GRCm39) S344P probably damaging Het
Ces1g A T 8: 94,033,582 (GRCm39) Y447N probably benign Het
Cfap54 A T 10: 92,883,923 (GRCm39) L277Q probably damaging Het
Cfh A G 1: 140,028,615 (GRCm39) Y1027H probably damaging Het
Clcnkb T A 4: 141,142,525 (GRCm39) I28F possibly damaging Het
Clec4d A G 6: 123,244,068 (GRCm39) D59G probably damaging Het
Colq G A 14: 31,269,409 (GRCm39) P153S probably damaging Het
Crybg1 T A 10: 43,862,275 (GRCm39) T1500S probably damaging Het
Cyp2d34 T A 15: 82,501,725 (GRCm39) R262W probably damaging Het
Dennd4b C G 3: 90,178,912 (GRCm39) L559V probably damaging Het
Dhrs1 A G 14: 55,976,766 (GRCm39) V306A probably benign Het
Diaph1 A T 18: 37,987,626 (GRCm39) D1043E possibly damaging Het
Dis3 G T 14: 99,323,539 (GRCm39) D538E probably damaging Het
Dnai2 T G 11: 114,641,206 (GRCm39) S344A probably benign Het
Dner C T 1: 84,423,311 (GRCm39) V431M probably damaging Het
Dnm1l A G 16: 16,160,559 (GRCm39) probably null Het
Eps15 T G 4: 109,170,115 (GRCm39) L139* probably null Het
Fam193a T A 5: 34,623,636 (GRCm39) I55N possibly damaging Het
Gm10308 T A 17: 91,396,385 (GRCm39) Y102* probably null Het
Gm10509 A G 17: 21,909,762 (GRCm39) K30E possibly damaging Het
Gpr155 T C 2: 73,197,921 (GRCm39) M400V probably benign Het
H2-M10.2 T C 17: 36,597,015 (GRCm39) probably benign Het
Heatr1 G T 13: 12,411,341 (GRCm39) A61S probably benign Het
Helb G T 10: 119,930,147 (GRCm39) T744K probably damaging Het
Hmcn1 C A 1: 150,474,781 (GRCm39) W4702L probably damaging Het
Hmcn2 C T 2: 31,286,132 (GRCm39) R2095W probably damaging Het
Igfbp3 G C 11: 7,158,461 (GRCm39) D267E probably damaging Het
Ighmbp2 T A 19: 3,318,669 (GRCm39) H469L probably damaging Het
Kcnj3 A C 2: 55,327,232 (GRCm39) K7T probably damaging Het
Krtap5-5 T G 7: 141,783,358 (GRCm39) K97N unknown Het
Lcor T C 19: 41,547,705 (GRCm39) S430P probably benign Het
Lpin1 A G 12: 16,588,541 (GRCm39) V883A probably damaging Het
Lrp1b T C 2: 41,000,837 (GRCm39) Y2243C probably damaging Het
Lrrc46 G A 11: 96,925,556 (GRCm39) probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mpdz C T 4: 81,225,114 (GRCm39) V1438M possibly damaging Het
Muc21 A T 17: 35,930,131 (GRCm39) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm39) L635* probably null Het
Nipbl T C 15: 8,368,035 (GRCm39) N1202D possibly damaging Het
Nphs1 A G 7: 30,160,959 (GRCm39) D196G probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or8b42 A T 9: 38,342,291 (GRCm39) I238F probably benign Het
Or8k16 A G 2: 85,520,427 (GRCm39) Y218C probably damaging Het
Pax8 A T 2: 24,325,833 (GRCm39) N350K probably damaging Het
Pik3cd T C 4: 149,743,207 (GRCm39) K298E probably benign Het
Pkd1 C T 17: 24,813,459 (GRCm39) R4000C probably damaging Het
Pkn2 A T 3: 142,516,488 (GRCm39) V546D possibly damaging Het
Plcg2 A G 8: 118,319,447 (GRCm39) K673E probably benign Het
Pld4 T G 12: 112,729,826 (GRCm39) probably null Het
Plek A T 11: 16,942,901 (GRCm39) N130K probably damaging Het
Prune2 G A 19: 17,101,068 (GRCm39) D2191N probably benign Het
Ptgis T C 2: 167,048,723 (GRCm39) Y431C probably damaging Het
Rhbdf2 T C 11: 116,498,092 (GRCm39) S36G probably benign Het
Rtn4ip1 C T 10: 43,786,826 (GRCm39) A178V probably damaging Het
Rxfp1 A G 3: 79,578,188 (GRCm39) S168P probably benign Het
Sec24a A G 11: 51,624,590 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slitrk6 C T 14: 110,987,984 (GRCm39) M574I probably benign Het
Slk T C 19: 47,611,116 (GRCm39) F861L probably damaging Het
Smpd3 C A 8: 106,991,603 (GRCm39) A317S probably benign Het
Spopfm1 A T 3: 94,173,525 (GRCm39) M174L probably benign Het
Spz1 T A 13: 92,711,633 (GRCm39) Q281L probably damaging Het
Syde1 T A 10: 78,422,814 (GRCm39) R519S probably benign Het
Taf4 T C 2: 179,618,324 (GRCm39) H39R unknown Het
Tbx5 A T 5: 119,983,178 (GRCm39) probably null Het
Tektl1 T A 10: 78,583,031 (GRCm39) K451M probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Th G A 7: 142,451,903 (GRCm39) Q19* probably null Het
Tmprss11a T A 5: 86,568,038 (GRCm39) I230F probably damaging Het
Tnfrsf14 T A 4: 155,009,779 (GRCm39) H50L possibly damaging Het
Tpp2 T A 1: 44,017,885 (GRCm39) probably null Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim2 A G 3: 84,098,107 (GRCm39) I398T possibly damaging Het
Trpc5 A T X: 143,264,222 (GRCm39) S212T probably damaging Het
Ttn A G 2: 76,617,678 (GRCm39) probably benign Het
Unc80 A G 1: 66,678,407 (GRCm39) T2063A possibly damaging Het
Usp37 A T 1: 74,518,814 (GRCm39) S260T probably benign Het
Vcan A G 13: 89,839,800 (GRCm39) S1915P probably benign Het
Vmn1r33 T A 6: 66,589,282 (GRCm39) I91F possibly damaging Het
Zfp422 T C 6: 116,603,385 (GRCm39) T205A probably benign Het
Other mutations in Or2b2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Or2b2b APN 13 21,858,787 (GRCm39) missense probably benign 0.12
IGL02886:Or2b2b APN 13 21,859,122 (GRCm39) utr 5 prime probably benign
IGL03157:Or2b2b APN 13 21,859,112 (GRCm39) start codon destroyed probably null 0.48
R1540:Or2b2b UTSW 13 21,858,700 (GRCm39) missense probably benign 0.11
R1843:Or2b2b UTSW 13 21,858,842 (GRCm39) missense probably benign 0.00
R3793:Or2b2b UTSW 13 21,859,153 (GRCm39) splice site probably null
R5707:Or2b2b UTSW 13 21,858,769 (GRCm39) missense probably damaging 1.00
R7566:Or2b2b UTSW 13 21,858,737 (GRCm39) missense possibly damaging 0.61
R8781:Or2b2b UTSW 13 21,859,013 (GRCm39) missense probably damaging 1.00
R8849:Or2b2b UTSW 13 21,858,226 (GRCm39) missense possibly damaging 0.67
R9070:Or2b2b UTSW 13 21,858,985 (GRCm39) missense probably benign 0.03
R9462:Or2b2b UTSW 13 21,859,015 (GRCm39) missense probably benign 0.19
Z1177:Or2b2b UTSW 13 21,859,324 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTTGCTGAAGCCACTGATCC -3'
(R):5'- GAGAGCATCTCACGGGAGTTCATTC -3'

Sequencing Primer
(F):5'- TGATCCAACATGCAGCCG -3'
(R):5'- TCACGGGAGTTCATTCTCTTAG -3'
Posted On 2014-05-23