Incidental Mutation 'R1756:Acin1'
ID194894
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Nameapoptotic chromatin condensation inducer 1
Synonyms2610510L13Rik, Acinus, 2610036I19Rik
MMRRC Submission 039788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1756 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54642161-54686931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54665204 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000022793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000111484] [ENSMUST00000125265]
Predicted Effect probably benign
Transcript: ENSMUST00000022793
AA Change: V377A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: V377A

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111484
AA Change: V337A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: V337A

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125265
AA Change: V231A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120445
Gene: ENSMUSG00000022185
AA Change: V231A

DomainStartEndE-ValueType
Blast:BRLZ 1 27 3e-9 BLAST
coiled coil region 32 66 N/A INTRINSIC
coiled coil region 113 154 N/A INTRINSIC
low complexity region 232 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141993
Predicted Effect unknown
Transcript: ENSMUST00000147714
AA Change: V322A
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: V322A

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,068,061 H382Q possibly damaging Het
A330008L17Rik C A 8: 99,421,882 noncoding transcript Het
Adam39 A T 8: 40,825,324 I251F probably damaging Het
Adnp2 A T 18: 80,127,697 *1166K probably null Het
Akap12 T A 10: 4,357,574 D1461E probably benign Het
Apba1 A G 19: 23,893,692 D296G possibly damaging Het
Apol7a G T 15: 77,393,471 L26M possibly damaging Het
Bcl2 C T 1: 106,712,392 M163I probably damaging Het
Cap2 T G 13: 46,531,013 I53R probably benign Het
Ccdc105 T A 10: 78,747,197 K451M probably damaging Het
Ccdc74a T C 16: 17,650,468 V318A possibly damaging Het
Ccnb2 A G 9: 70,410,788 V234A probably benign Het
Cd207 C T 6: 83,675,597 V184I probably benign Het
Cdk12 C A 11: 98,241,761 C1005* probably null Het
Cep83 T C 10: 94,750,267 S344P probably damaging Het
Ces1g A T 8: 93,306,954 Y447N probably benign Het
Cfap54 A T 10: 93,048,061 L277Q probably damaging Het
Cfh A G 1: 140,100,877 Y1027H probably damaging Het
Clcnkb T A 4: 141,415,214 I28F possibly damaging Het
Clec4d A G 6: 123,267,109 D59G probably damaging Het
Colq G A 14: 31,547,452 P153S probably damaging Het
Crybg1 T A 10: 43,986,279 T1500S probably damaging Het
Cyp2d34 T A 15: 82,617,524 R262W probably damaging Het
Dennd4b C G 3: 90,271,605 L559V probably damaging Het
Dhrs1 A G 14: 55,739,309 V306A probably benign Het
Diaph1 A T 18: 37,854,573 D1043E possibly damaging Het
Dis3 G T 14: 99,086,103 D538E probably damaging Het
Dnaic2 T G 11: 114,750,380 S344A probably benign Het
Dner C T 1: 84,445,590 V431M probably damaging Het
Dnm1l A G 16: 16,342,695 probably null Het
Eps15 T G 4: 109,312,918 L139* probably null Het
Fam193a T A 5: 34,466,292 I55N possibly damaging Het
Gm10308 T A 17: 91,088,957 Y102* probably null Het
Gm10509 A G 17: 21,690,855 K30E possibly damaging Het
Gm4778 A T 3: 94,266,218 M174L probably benign Het
Gm9573 A T 17: 35,619,239 probably benign Het
Gpr155 T C 2: 73,367,577 M400V probably benign Het
H2-M10.2 T C 17: 36,286,123 probably benign Het
Heatr1 G T 13: 12,396,460 A61S probably benign Het
Helb G T 10: 120,094,242 T744K probably damaging Het
Hmcn1 C A 1: 150,599,030 W4702L probably damaging Het
Hmcn2 C T 2: 31,396,120 R2095W probably damaging Het
Igfbp3 G C 11: 7,208,461 D267E probably damaging Het
Ighmbp2 T A 19: 3,268,669 H469L probably damaging Het
Kcnj3 A C 2: 55,437,220 K7T probably damaging Het
Krtap5-5 T G 7: 142,229,621 K97N unknown Het
Lcor T C 19: 41,559,266 S430P probably benign Het
Lpin1 A G 12: 16,538,540 V883A probably damaging Het
Lrp1b T C 2: 41,110,825 Y2243C probably damaging Het
Lrrc46 G A 11: 97,034,730 probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Ncbp1 T A 4: 46,169,131 L635* probably null Het
Nipbl T C 15: 8,338,551 N1202D possibly damaging Het
Nphs1 A G 7: 30,461,534 D196G probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1008 A G 2: 85,690,083 Y218C probably damaging Het
Olfr1360 A G 13: 21,674,695 I83T probably benign Het
Olfr901 A T 9: 38,430,995 I238F probably benign Het
Pax8 A T 2: 24,435,821 N350K probably damaging Het
Pik3cd T C 4: 149,658,750 K298E probably benign Het
Pkd1 C T 17: 24,594,485 R4000C probably damaging Het
Pkn2 A T 3: 142,810,727 V546D possibly damaging Het
Plcg2 A G 8: 117,592,708 K673E probably benign Het
Pld4 T G 12: 112,763,392 probably null Het
Plek A T 11: 16,992,901 N130K probably damaging Het
Prune2 G A 19: 17,123,704 D2191N probably benign Het
Ptgis T C 2: 167,206,803 Y431C probably damaging Het
Rhbdf2 T C 11: 116,607,266 S36G probably benign Het
Rtn4ip1 C T 10: 43,910,830 A178V probably damaging Het
Rxfp1 A G 3: 79,670,881 S168P probably benign Het
Sec24a A G 11: 51,733,763 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk6 C T 14: 110,750,552 M574I probably benign Het
Slk T C 19: 47,622,677 F861L probably damaging Het
Smpd3 C A 8: 106,264,971 A317S probably benign Het
Spz1 T A 13: 92,575,125 Q281L probably damaging Het
Syde1 T A 10: 78,586,980 R519S probably benign Het
Taf4 T C 2: 179,976,531 H39R unknown Het
Tbx5 A T 5: 119,845,113 probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Th G A 7: 142,898,166 Q19* probably null Het
Tmprss11a T A 5: 86,420,179 I230F probably damaging Het
Tnfrsf14 T A 4: 154,925,322 H50L possibly damaging Het
Tpp2 T A 1: 43,978,725 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim2 A G 3: 84,190,800 I398T possibly damaging Het
Trpc5 A T X: 144,481,226 S212T probably damaging Het
Ttn A G 2: 76,787,334 probably benign Het
Unc80 A G 1: 66,639,248 T2063A possibly damaging Het
Usp37 A T 1: 74,479,655 S260T probably benign Het
Vcan A G 13: 89,691,681 S1915P probably benign Het
Vmn1r33 T A 6: 66,612,298 I91F possibly damaging Het
Zfp422 T C 6: 116,626,424 T205A probably benign Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54646800 missense probably damaging 1.00
IGL01530:Acin1 APN 14 54643986 missense probably damaging 1.00
IGL02396:Acin1 APN 14 54644799 intron probably benign
IGL02967:Acin1 APN 14 54642753 missense possibly damaging 0.80
Protuberant UTSW 14 54645283 missense probably damaging 1.00
R0411:Acin1 UTSW 14 54646774 missense probably damaging 1.00
R0723:Acin1 UTSW 14 54665451 missense probably damaging 0.98
R0755:Acin1 UTSW 14 54651835 start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54653528 unclassified probably benign
R1600:Acin1 UTSW 14 54643717 intron probably benign
R1682:Acin1 UTSW 14 54663718 missense probably damaging 1.00
R1721:Acin1 UTSW 14 54664538 missense probably benign 0.01
R1867:Acin1 UTSW 14 54644261 missense probably damaging 1.00
R1997:Acin1 UTSW 14 54646699 splice site probably null
R2067:Acin1 UTSW 14 54665254 missense probably damaging 1.00
R3947:Acin1 UTSW 14 54679333 missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54653894 unclassified probably benign
R4476:Acin1 UTSW 14 54645330 missense probably damaging 1.00
R4501:Acin1 UTSW 14 54686587 missense probably damaging 1.00
R4547:Acin1 UTSW 14 54645667 missense probably benign 0.01
R4621:Acin1 UTSW 14 54653443 unclassified probably benign
R4657:Acin1 UTSW 14 54643047 missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54686758 missense probably benign 0.00
R4696:Acin1 UTSW 14 54643017 intron probably benign
R4806:Acin1 UTSW 14 54679228 splice site probably benign
R4826:Acin1 UTSW 14 54664617 missense probably damaging 0.97
R5096:Acin1 UTSW 14 54679222 intron probably benign
R5153:Acin1 UTSW 14 54645613 missense probably benign 0.25
R5223:Acin1 UTSW 14 54642941 frame shift probably null
R5260:Acin1 UTSW 14 54642822 intron probably benign
R5525:Acin1 UTSW 14 54664391 missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54678738 splice site probably null
R5902:Acin1 UTSW 14 54663673 missense probably benign 0.01
R6211:Acin1 UTSW 14 54644046 missense probably damaging 1.00
R6524:Acin1 UTSW 14 54645283 missense probably damaging 1.00
R6560:Acin1 UTSW 14 54678833 missense probably benign 0.24
R6916:Acin1 UTSW 14 54665416 missense probably benign 0.27
R7201:Acin1 UTSW 14 54664899 missense possibly damaging 0.83
X0021:Acin1 UTSW 14 54667101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGCATCTGTGTTAGGAGGAGAC -3'
(R):5'- GGTGGTGGATGAGAAACCCCTAAAC -3'

Sequencing Primer
(F):5'- CATCTGTGTTAGGAGGAGACAACTG -3'
(R):5'- TGGATGAGAAACCCCTAAACATCAG -3'
Posted On2014-05-23