Incidental Mutation 'R1756:Acin1'
ID 194894
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Name apoptotic chromatin condensation inducer 1
Synonyms 2610036I19Rik, 2610510L13Rik, Acinus
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R1756 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 54879618-54924388 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54902661 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000022793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000111484] [ENSMUST00000125265]
AlphaFold Q9JIX8
Predicted Effect probably benign
Transcript: ENSMUST00000022793
AA Change: V377A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: V377A

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111484
AA Change: V337A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: V337A

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125265
AA Change: V231A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120445
Gene: ENSMUSG00000022185
AA Change: V231A

DomainStartEndE-ValueType
Blast:BRLZ 1 27 3e-9 BLAST
coiled coil region 32 66 N/A INTRINSIC
coiled coil region 113 154 N/A INTRINSIC
low complexity region 232 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141993
Predicted Effect unknown
Transcript: ENSMUST00000147714
AA Change: V322A
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: V322A

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 100,148,514 (GRCm39) noncoding transcript Het
Adam39 A T 8: 41,278,361 (GRCm39) I251F probably damaging Het
Adnp2 A T 18: 80,170,912 (GRCm39) *1166K probably null Het
Akap12 T A 10: 4,307,574 (GRCm39) D1461E probably benign Het
Aopep T A 13: 63,215,875 (GRCm39) H382Q possibly damaging Het
Apba1 A G 19: 23,871,056 (GRCm39) D296G possibly damaging Het
Apol7a G T 15: 77,277,671 (GRCm39) L26M possibly damaging Het
Bcl2 C T 1: 106,640,122 (GRCm39) M163I probably damaging Het
Cap2 T G 13: 46,684,489 (GRCm39) I53R probably benign Het
Ccdc74a T C 16: 17,468,332 (GRCm39) V318A possibly damaging Het
Ccnb2 A G 9: 70,318,070 (GRCm39) V234A probably benign Het
Cd207 C T 6: 83,652,579 (GRCm39) V184I probably benign Het
Cdk12 C A 11: 98,132,587 (GRCm39) C1005* probably null Het
Cep83 T C 10: 94,586,129 (GRCm39) S344P probably damaging Het
Ces1g A T 8: 94,033,582 (GRCm39) Y447N probably benign Het
Cfap54 A T 10: 92,883,923 (GRCm39) L277Q probably damaging Het
Cfh A G 1: 140,028,615 (GRCm39) Y1027H probably damaging Het
Clcnkb T A 4: 141,142,525 (GRCm39) I28F possibly damaging Het
Clec4d A G 6: 123,244,068 (GRCm39) D59G probably damaging Het
Colq G A 14: 31,269,409 (GRCm39) P153S probably damaging Het
Crybg1 T A 10: 43,862,275 (GRCm39) T1500S probably damaging Het
Cyp2d34 T A 15: 82,501,725 (GRCm39) R262W probably damaging Het
Dennd4b C G 3: 90,178,912 (GRCm39) L559V probably damaging Het
Dhrs1 A G 14: 55,976,766 (GRCm39) V306A probably benign Het
Diaph1 A T 18: 37,987,626 (GRCm39) D1043E possibly damaging Het
Dis3 G T 14: 99,323,539 (GRCm39) D538E probably damaging Het
Dnai2 T G 11: 114,641,206 (GRCm39) S344A probably benign Het
Dner C T 1: 84,423,311 (GRCm39) V431M probably damaging Het
Dnm1l A G 16: 16,160,559 (GRCm39) probably null Het
Eps15 T G 4: 109,170,115 (GRCm39) L139* probably null Het
Fam193a T A 5: 34,623,636 (GRCm39) I55N possibly damaging Het
Gm10308 T A 17: 91,396,385 (GRCm39) Y102* probably null Het
Gm10509 A G 17: 21,909,762 (GRCm39) K30E possibly damaging Het
Gpr155 T C 2: 73,197,921 (GRCm39) M400V probably benign Het
H2-M10.2 T C 17: 36,597,015 (GRCm39) probably benign Het
Heatr1 G T 13: 12,411,341 (GRCm39) A61S probably benign Het
Helb G T 10: 119,930,147 (GRCm39) T744K probably damaging Het
Hmcn1 C A 1: 150,474,781 (GRCm39) W4702L probably damaging Het
Hmcn2 C T 2: 31,286,132 (GRCm39) R2095W probably damaging Het
Igfbp3 G C 11: 7,158,461 (GRCm39) D267E probably damaging Het
Ighmbp2 T A 19: 3,318,669 (GRCm39) H469L probably damaging Het
Kcnj3 A C 2: 55,327,232 (GRCm39) K7T probably damaging Het
Krtap5-5 T G 7: 141,783,358 (GRCm39) K97N unknown Het
Lcor T C 19: 41,547,705 (GRCm39) S430P probably benign Het
Lpin1 A G 12: 16,588,541 (GRCm39) V883A probably damaging Het
Lrp1b T C 2: 41,000,837 (GRCm39) Y2243C probably damaging Het
Lrrc46 G A 11: 96,925,556 (GRCm39) probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mpdz C T 4: 81,225,114 (GRCm39) V1438M possibly damaging Het
Muc21 A T 17: 35,930,131 (GRCm39) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm39) L635* probably null Het
Nipbl T C 15: 8,368,035 (GRCm39) N1202D possibly damaging Het
Nphs1 A G 7: 30,160,959 (GRCm39) D196G probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2b2b A G 13: 21,858,865 (GRCm39) I83T probably benign Het
Or8b42 A T 9: 38,342,291 (GRCm39) I238F probably benign Het
Or8k16 A G 2: 85,520,427 (GRCm39) Y218C probably damaging Het
Pax8 A T 2: 24,325,833 (GRCm39) N350K probably damaging Het
Pik3cd T C 4: 149,743,207 (GRCm39) K298E probably benign Het
Pkd1 C T 17: 24,813,459 (GRCm39) R4000C probably damaging Het
Pkn2 A T 3: 142,516,488 (GRCm39) V546D possibly damaging Het
Plcg2 A G 8: 118,319,447 (GRCm39) K673E probably benign Het
Pld4 T G 12: 112,729,826 (GRCm39) probably null Het
Plek A T 11: 16,942,901 (GRCm39) N130K probably damaging Het
Prune2 G A 19: 17,101,068 (GRCm39) D2191N probably benign Het
Ptgis T C 2: 167,048,723 (GRCm39) Y431C probably damaging Het
Rhbdf2 T C 11: 116,498,092 (GRCm39) S36G probably benign Het
Rtn4ip1 C T 10: 43,786,826 (GRCm39) A178V probably damaging Het
Rxfp1 A G 3: 79,578,188 (GRCm39) S168P probably benign Het
Sec24a A G 11: 51,624,590 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slitrk6 C T 14: 110,987,984 (GRCm39) M574I probably benign Het
Slk T C 19: 47,611,116 (GRCm39) F861L probably damaging Het
Smpd3 C A 8: 106,991,603 (GRCm39) A317S probably benign Het
Spopfm1 A T 3: 94,173,525 (GRCm39) M174L probably benign Het
Spz1 T A 13: 92,711,633 (GRCm39) Q281L probably damaging Het
Syde1 T A 10: 78,422,814 (GRCm39) R519S probably benign Het
Taf4 T C 2: 179,618,324 (GRCm39) H39R unknown Het
Tbx5 A T 5: 119,983,178 (GRCm39) probably null Het
Tektl1 T A 10: 78,583,031 (GRCm39) K451M probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Th G A 7: 142,451,903 (GRCm39) Q19* probably null Het
Tmprss11a T A 5: 86,568,038 (GRCm39) I230F probably damaging Het
Tnfrsf14 T A 4: 155,009,779 (GRCm39) H50L possibly damaging Het
Tpp2 T A 1: 44,017,885 (GRCm39) probably null Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Trim2 A G 3: 84,098,107 (GRCm39) I398T possibly damaging Het
Trpc5 A T X: 143,264,222 (GRCm39) S212T probably damaging Het
Ttn A G 2: 76,617,678 (GRCm39) probably benign Het
Unc80 A G 1: 66,678,407 (GRCm39) T2063A possibly damaging Het
Usp37 A T 1: 74,518,814 (GRCm39) S260T probably benign Het
Vcan A G 13: 89,839,800 (GRCm39) S1915P probably benign Het
Vmn1r33 T A 6: 66,589,282 (GRCm39) I91F possibly damaging Het
Zfp422 T C 6: 116,603,385 (GRCm39) T205A probably benign Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54,884,257 (GRCm39) missense probably damaging 1.00
IGL01530:Acin1 APN 14 54,881,443 (GRCm39) missense probably damaging 1.00
IGL02396:Acin1 APN 14 54,882,256 (GRCm39) intron probably benign
IGL02967:Acin1 APN 14 54,880,210 (GRCm39) missense possibly damaging 0.80
Protuberant UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R0411:Acin1 UTSW 14 54,884,231 (GRCm39) missense probably damaging 1.00
R0723:Acin1 UTSW 14 54,902,908 (GRCm39) missense probably damaging 0.98
R0755:Acin1 UTSW 14 54,889,292 (GRCm39) start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54,890,985 (GRCm39) unclassified probably benign
R1600:Acin1 UTSW 14 54,881,174 (GRCm39) intron probably benign
R1682:Acin1 UTSW 14 54,901,175 (GRCm39) missense probably damaging 1.00
R1721:Acin1 UTSW 14 54,901,995 (GRCm39) missense probably benign 0.01
R1867:Acin1 UTSW 14 54,881,718 (GRCm39) missense probably damaging 1.00
R1997:Acin1 UTSW 14 54,884,156 (GRCm39) splice site probably null
R2067:Acin1 UTSW 14 54,902,711 (GRCm39) missense probably damaging 1.00
R3947:Acin1 UTSW 14 54,916,790 (GRCm39) missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54,891,351 (GRCm39) unclassified probably benign
R4476:Acin1 UTSW 14 54,882,787 (GRCm39) missense probably damaging 1.00
R4501:Acin1 UTSW 14 54,924,044 (GRCm39) missense probably damaging 1.00
R4547:Acin1 UTSW 14 54,883,124 (GRCm39) missense probably benign 0.01
R4621:Acin1 UTSW 14 54,890,900 (GRCm39) unclassified probably benign
R4657:Acin1 UTSW 14 54,880,504 (GRCm39) missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54,924,215 (GRCm39) missense probably benign 0.00
R4696:Acin1 UTSW 14 54,880,474 (GRCm39) intron probably benign
R4806:Acin1 UTSW 14 54,916,685 (GRCm39) splice site probably benign
R4826:Acin1 UTSW 14 54,902,074 (GRCm39) missense probably damaging 0.97
R5096:Acin1 UTSW 14 54,916,679 (GRCm39) intron probably benign
R5153:Acin1 UTSW 14 54,883,070 (GRCm39) missense probably benign 0.25
R5223:Acin1 UTSW 14 54,880,398 (GRCm39) frame shift probably null
R5260:Acin1 UTSW 14 54,880,279 (GRCm39) intron probably benign
R5525:Acin1 UTSW 14 54,901,848 (GRCm39) missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54,916,195 (GRCm39) splice site probably null
R5902:Acin1 UTSW 14 54,901,130 (GRCm39) missense probably benign 0.01
R6211:Acin1 UTSW 14 54,881,503 (GRCm39) missense probably damaging 1.00
R6524:Acin1 UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R6560:Acin1 UTSW 14 54,916,290 (GRCm39) missense probably benign 0.24
R6916:Acin1 UTSW 14 54,902,873 (GRCm39) missense probably benign 0.27
R7201:Acin1 UTSW 14 54,902,356 (GRCm39) missense possibly damaging 0.83
R7833:Acin1 UTSW 14 54,902,059 (GRCm39) missense possibly damaging 0.83
R8096:Acin1 UTSW 14 54,882,726 (GRCm39) missense possibly damaging 0.80
R8167:Acin1 UTSW 14 54,902,337 (GRCm39) missense probably benign 0.01
R8421:Acin1 UTSW 14 54,880,486 (GRCm39) missense unknown
R8771:Acin1 UTSW 14 54,880,496 (GRCm39) missense unknown
R8862:Acin1 UTSW 14 54,901,172 (GRCm39) missense probably benign 0.00
R9645:Acin1 UTSW 14 54,901,913 (GRCm39) missense probably benign 0.16
R9755:Acin1 UTSW 14 54,889,292 (GRCm39) missense probably damaging 0.99
X0021:Acin1 UTSW 14 54,904,558 (GRCm39) missense probably damaging 1.00
Z1177:Acin1 UTSW 14 54,880,207 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAGCATCTGTGTTAGGAGGAGAC -3'
(R):5'- GGTGGTGGATGAGAAACCCCTAAAC -3'

Sequencing Primer
(F):5'- CATCTGTGTTAGGAGGAGACAACTG -3'
(R):5'- TGGATGAGAAACCCCTAAACATCAG -3'
Posted On 2014-05-23