Incidental Mutation 'R1756:Trappc9'
ID 194900
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 039788-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1756 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 72461469-72933053 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72897816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 377 (R377W)
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: R189W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R189W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089770
AA Change: R368W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168191
AA Change: R368W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R368W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170633
AA Change: R377W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R377W

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228960
AA Change: R368W

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230270
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik C A 8: 100,148,514 (GRCm39) noncoding transcript Het
Acin1 A G 14: 54,902,661 (GRCm39) V377A probably benign Het
Adam39 A T 8: 41,278,361 (GRCm39) I251F probably damaging Het
Adnp2 A T 18: 80,170,912 (GRCm39) *1166K probably null Het
Akap12 T A 10: 4,307,574 (GRCm39) D1461E probably benign Het
Aopep T A 13: 63,215,875 (GRCm39) H382Q possibly damaging Het
Apba1 A G 19: 23,871,056 (GRCm39) D296G possibly damaging Het
Apol7a G T 15: 77,277,671 (GRCm39) L26M possibly damaging Het
Bcl2 C T 1: 106,640,122 (GRCm39) M163I probably damaging Het
Cap2 T G 13: 46,684,489 (GRCm39) I53R probably benign Het
Ccdc74a T C 16: 17,468,332 (GRCm39) V318A possibly damaging Het
Ccnb2 A G 9: 70,318,070 (GRCm39) V234A probably benign Het
Cd207 C T 6: 83,652,579 (GRCm39) V184I probably benign Het
Cdk12 C A 11: 98,132,587 (GRCm39) C1005* probably null Het
Cep83 T C 10: 94,586,129 (GRCm39) S344P probably damaging Het
Ces1g A T 8: 94,033,582 (GRCm39) Y447N probably benign Het
Cfap54 A T 10: 92,883,923 (GRCm39) L277Q probably damaging Het
Cfh A G 1: 140,028,615 (GRCm39) Y1027H probably damaging Het
Clcnkb T A 4: 141,142,525 (GRCm39) I28F possibly damaging Het
Clec4d A G 6: 123,244,068 (GRCm39) D59G probably damaging Het
Colq G A 14: 31,269,409 (GRCm39) P153S probably damaging Het
Crybg1 T A 10: 43,862,275 (GRCm39) T1500S probably damaging Het
Cyp2d34 T A 15: 82,501,725 (GRCm39) R262W probably damaging Het
Dennd4b C G 3: 90,178,912 (GRCm39) L559V probably damaging Het
Dhrs1 A G 14: 55,976,766 (GRCm39) V306A probably benign Het
Diaph1 A T 18: 37,987,626 (GRCm39) D1043E possibly damaging Het
Dis3 G T 14: 99,323,539 (GRCm39) D538E probably damaging Het
Dnai2 T G 11: 114,641,206 (GRCm39) S344A probably benign Het
Dner C T 1: 84,423,311 (GRCm39) V431M probably damaging Het
Dnm1l A G 16: 16,160,559 (GRCm39) probably null Het
Eps15 T G 4: 109,170,115 (GRCm39) L139* probably null Het
Fam193a T A 5: 34,623,636 (GRCm39) I55N possibly damaging Het
Gm10308 T A 17: 91,396,385 (GRCm39) Y102* probably null Het
Gm10509 A G 17: 21,909,762 (GRCm39) K30E possibly damaging Het
Gpr155 T C 2: 73,197,921 (GRCm39) M400V probably benign Het
H2-M10.2 T C 17: 36,597,015 (GRCm39) probably benign Het
Heatr1 G T 13: 12,411,341 (GRCm39) A61S probably benign Het
Helb G T 10: 119,930,147 (GRCm39) T744K probably damaging Het
Hmcn1 C A 1: 150,474,781 (GRCm39) W4702L probably damaging Het
Hmcn2 C T 2: 31,286,132 (GRCm39) R2095W probably damaging Het
Igfbp3 G C 11: 7,158,461 (GRCm39) D267E probably damaging Het
Ighmbp2 T A 19: 3,318,669 (GRCm39) H469L probably damaging Het
Kcnj3 A C 2: 55,327,232 (GRCm39) K7T probably damaging Het
Krtap5-5 T G 7: 141,783,358 (GRCm39) K97N unknown Het
Lcor T C 19: 41,547,705 (GRCm39) S430P probably benign Het
Lpin1 A G 12: 16,588,541 (GRCm39) V883A probably damaging Het
Lrp1b T C 2: 41,000,837 (GRCm39) Y2243C probably damaging Het
Lrrc46 G A 11: 96,925,556 (GRCm39) probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mpdz C T 4: 81,225,114 (GRCm39) V1438M possibly damaging Het
Muc21 A T 17: 35,930,131 (GRCm39) probably benign Het
Ncbp1 T A 4: 46,169,131 (GRCm39) L635* probably null Het
Nipbl T C 15: 8,368,035 (GRCm39) N1202D possibly damaging Het
Nphs1 A G 7: 30,160,959 (GRCm39) D196G probably benign Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or2b2b A G 13: 21,858,865 (GRCm39) I83T probably benign Het
Or8b42 A T 9: 38,342,291 (GRCm39) I238F probably benign Het
Or8k16 A G 2: 85,520,427 (GRCm39) Y218C probably damaging Het
Pax8 A T 2: 24,325,833 (GRCm39) N350K probably damaging Het
Pik3cd T C 4: 149,743,207 (GRCm39) K298E probably benign Het
Pkd1 C T 17: 24,813,459 (GRCm39) R4000C probably damaging Het
Pkn2 A T 3: 142,516,488 (GRCm39) V546D possibly damaging Het
Plcg2 A G 8: 118,319,447 (GRCm39) K673E probably benign Het
Pld4 T G 12: 112,729,826 (GRCm39) probably null Het
Plek A T 11: 16,942,901 (GRCm39) N130K probably damaging Het
Prune2 G A 19: 17,101,068 (GRCm39) D2191N probably benign Het
Ptgis T C 2: 167,048,723 (GRCm39) Y431C probably damaging Het
Rhbdf2 T C 11: 116,498,092 (GRCm39) S36G probably benign Het
Rtn4ip1 C T 10: 43,786,826 (GRCm39) A178V probably damaging Het
Rxfp1 A G 3: 79,578,188 (GRCm39) S168P probably benign Het
Sec24a A G 11: 51,624,590 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Slitrk6 C T 14: 110,987,984 (GRCm39) M574I probably benign Het
Slk T C 19: 47,611,116 (GRCm39) F861L probably damaging Het
Smpd3 C A 8: 106,991,603 (GRCm39) A317S probably benign Het
Spopfm1 A T 3: 94,173,525 (GRCm39) M174L probably benign Het
Spz1 T A 13: 92,711,633 (GRCm39) Q281L probably damaging Het
Syde1 T A 10: 78,422,814 (GRCm39) R519S probably benign Het
Taf4 T C 2: 179,618,324 (GRCm39) H39R unknown Het
Tbx5 A T 5: 119,983,178 (GRCm39) probably null Het
Tektl1 T A 10: 78,583,031 (GRCm39) K451M probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Th G A 7: 142,451,903 (GRCm39) Q19* probably null Het
Tmprss11a T A 5: 86,568,038 (GRCm39) I230F probably damaging Het
Tnfrsf14 T A 4: 155,009,779 (GRCm39) H50L possibly damaging Het
Tpp2 T A 1: 44,017,885 (GRCm39) probably null Het
Trim2 A G 3: 84,098,107 (GRCm39) I398T possibly damaging Het
Trpc5 A T X: 143,264,222 (GRCm39) S212T probably damaging Het
Ttn A G 2: 76,617,678 (GRCm39) probably benign Het
Unc80 A G 1: 66,678,407 (GRCm39) T2063A possibly damaging Het
Usp37 A T 1: 74,518,814 (GRCm39) S260T probably benign Het
Vcan A G 13: 89,839,800 (GRCm39) S1915P probably benign Het
Vmn1r33 T A 6: 66,589,282 (GRCm39) I91F possibly damaging Het
Zfp422 T C 6: 116,603,385 (GRCm39) T205A probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 72,897,875 (GRCm39) missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72,808,858 (GRCm39) missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72,462,002 (GRCm39) missense probably benign 0.31
IGL01521:Trappc9 APN 15 72,924,016 (GRCm39) missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72,817,971 (GRCm39) missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72,871,841 (GRCm39) missense probably damaging 1.00
IGL02214:Trappc9 APN 15 72,884,731 (GRCm39) nonsense probably null
IGL02693:Trappc9 APN 15 72,835,542 (GRCm39) splice site probably benign
IGL03229:Trappc9 APN 15 72,930,305 (GRCm39) missense probably damaging 1.00
basilio UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
Boomboom UTSW 15 72,608,718 (GRCm39) nonsense probably null
bronto UTSW 15 72,930,087 (GRCm39) nonsense probably null
Earl UTSW 15 72,608,626 (GRCm39) nonsense probably null
Sotto_aceto UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72,824,931 (GRCm39) missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 72,903,447 (GRCm39) frame shift probably null
PIT4519001:Trappc9 UTSW 15 72,824,943 (GRCm39) missense probably benign
R0001:Trappc9 UTSW 15 72,835,511 (GRCm39) missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72,894,929 (GRCm38) intron probably benign
R0745:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0747:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72,824,981 (GRCm39) splice site probably benign
R0816:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0819:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0820:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72,461,956 (GRCm39) missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72,871,823 (GRCm39) missense probably damaging 0.99
R1119:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1266:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1453:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1454:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72,565,397 (GRCm39) nonsense probably null
R1543:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1563:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1565:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72,808,958 (GRCm39) nonsense probably null
R1712:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1789:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R1978:Trappc9 UTSW 15 72,871,874 (GRCm39) missense probably damaging 1.00
R2001:Trappc9 UTSW 15 72,929,885 (GRCm39) missense probably damaging 0.99
R2312:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2334:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R2926:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3123:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3124:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3125:Trappc9 UTSW 15 72,897,816 (GRCm39) missense probably damaging 1.00
R3813:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R4012:Trappc9 UTSW 15 72,903,472 (GRCm39) missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72,813,796 (GRCm39) missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72,462,641 (GRCm39) missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72,808,916 (GRCm39) missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72,808,909 (GRCm39) missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72,808,905 (GRCm39) missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72,785,215 (GRCm39) intron probably benign
R5128:Trappc9 UTSW 15 72,930,242 (GRCm39) missense probably damaging 1.00
R5228:Trappc9 UTSW 15 72,929,844 (GRCm39) missense probably damaging 1.00
R5362:Trappc9 UTSW 15 72,930,066 (GRCm39) missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72,557,188 (GRCm39) missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6032:Trappc9 UTSW 15 72,797,379 (GRCm39) missense probably benign 0.43
R6154:Trappc9 UTSW 15 72,929,930 (GRCm39) missense probably benign 0.03
R6372:Trappc9 UTSW 15 72,461,923 (GRCm39) missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72,461,993 (GRCm39) missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72,809,011 (GRCm39) splice site probably null
R6893:Trappc9 UTSW 15 72,797,499 (GRCm39) missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72,565,468 (GRCm39) missense probably benign 0.00
R7276:Trappc9 UTSW 15 72,924,119 (GRCm39) missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72,608,718 (GRCm39) nonsense probably null
R8260:Trappc9 UTSW 15 72,813,758 (GRCm39) nonsense probably null
R8399:Trappc9 UTSW 15 72,924,131 (GRCm39) missense probably damaging 1.00
R8683:Trappc9 UTSW 15 72,884,664 (GRCm39) missense probably benign 0.26
R8839:Trappc9 UTSW 15 72,930,087 (GRCm39) nonsense probably null
R8945:Trappc9 UTSW 15 72,929,945 (GRCm39) missense probably benign
R9083:Trappc9 UTSW 15 72,608,626 (GRCm39) nonsense probably null
R9323:Trappc9 UTSW 15 72,565,431 (GRCm39) missense probably benign 0.41
R9329:Trappc9 UTSW 15 72,673,202 (GRCm39) missense unknown
R9366:Trappc9 UTSW 15 72,808,937 (GRCm39) missense probably benign
R9723:Trappc9 UTSW 15 72,461,963 (GRCm39) missense possibly damaging 0.87
RF008:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF009:Trappc9 UTSW 15 72,673,136 (GRCm39) small insertion probably benign
RF014:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF016:Trappc9 UTSW 15 72,673,138 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,180 (GRCm39) small insertion probably benign
RF023:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF028:Trappc9 UTSW 15 72,673,139 (GRCm39) small insertion probably benign
RF029:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF030:Trappc9 UTSW 15 72,673,174 (GRCm39) small insertion probably benign
RF034:Trappc9 UTSW 15 72,673,147 (GRCm39) small insertion probably benign
RF036:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
RF038:Trappc9 UTSW 15 72,673,172 (GRCm39) small insertion probably benign
RF040:Trappc9 UTSW 15 72,673,141 (GRCm39) small insertion probably benign
RF042:Trappc9 UTSW 15 72,673,132 (GRCm39) small insertion probably benign
RF043:Trappc9 UTSW 15 72,673,154 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,155 (GRCm39) small insertion probably benign
RF049:Trappc9 UTSW 15 72,673,150 (GRCm39) small insertion probably benign
RF053:Trappc9 UTSW 15 72,673,177 (GRCm39) small insertion probably benign
RF057:Trappc9 UTSW 15 72,673,144 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,173 (GRCm39) small insertion probably benign
RF063:Trappc9 UTSW 15 72,673,169 (GRCm39) small insertion probably benign
Z1177:Trappc9 UTSW 15 72,924,011 (GRCm39) missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- GCATCTCACAAGTGACAAAGGCAAG -3'
(R):5'- TTGTGCCCGTTAAGACAGACCCTC -3'

Sequencing Primer
(F):5'- caaatcccagcaaccacac -3'
(R):5'- TCGGAAATAGCTTTCCCCGAG -3'
Posted On 2014-05-23