Mutagenetix > Incidental Mutation

Incidental Mutation 'R1756:Apba1'

194916

Institutional Source

Beutler Lab

Gene Symbol

Apba1

Ensembl Gene

ENSMUSG00000024897

Gene Name

amyloid beta (A4) precursor protein binding, family A, member 1

Synonyms

6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha

MMRRC Submission

039788-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1756 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

23758876-23949597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23893692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 296 (D296G)

Ref Sequence

ENSEMBL: ENSMUSP00000025830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025830]

AlphaFold

B2RUJ5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025830
AA Change: D296G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: D296G

Domain	Start	End	E-Value	Type
low complexity region	40	47	N/A	INTRINSIC
low complexity region	59	74	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	404	421	N/A	INTRINSIC
PTB	461	626	9.49e-33	SMART
PDZ	670	748	3.09e-15	SMART
PDZ	762	828	2.53e-11	SMART

Meta Mutation Damage Score

0.0591

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,068,061	H382Q	possibly damaging	Het
A330008L17Rik	C	A	8: 99,421,882		noncoding transcript	Het
Acin1	A	G	14: 54,665,204	V377A	probably benign	Het
Adam39	A	T	8: 40,825,324	I251F	probably damaging	Het
Adnp2	A	T	18: 80,127,697	*1166K	probably null	Het
Akap12	T	A	10: 4,357,574	D1461E	probably benign	Het
Apol7a	G	T	15: 77,393,471	L26M	possibly damaging	Het
Bcl2	C	T	1: 106,712,392	M163I	probably damaging	Het
Cap2	T	G	13: 46,531,013	I53R	probably benign	Het
Ccdc105	T	A	10: 78,747,197	K451M	probably damaging	Het
Ccdc74a	T	C	16: 17,650,468	V318A	possibly damaging	Het
Ccnb2	A	G	9: 70,410,788	V234A	probably benign	Het
Cd207	C	T	6: 83,675,597	V184I	probably benign	Het
Cdk12	C	A	11: 98,241,761	C1005*	probably null	Het
Cep83	T	C	10: 94,750,267	S344P	probably damaging	Het
Ces1g	A	T	8: 93,306,954	Y447N	probably benign	Het
Cfap54	A	T	10: 93,048,061	L277Q	probably damaging	Het
Cfh	A	G	1: 140,100,877	Y1027H	probably damaging	Het
Clcnkb	T	A	4: 141,415,214	I28F	possibly damaging	Het
Clec4d	A	G	6: 123,267,109	D59G	probably damaging	Het
Colq	G	A	14: 31,547,452	P153S	probably damaging	Het
Crybg1	T	A	10: 43,986,279	T1500S	probably damaging	Het
Cyp2d34	T	A	15: 82,617,524	R262W	probably damaging	Het
Dennd4b	C	G	3: 90,271,605	L559V	probably damaging	Het
Dhrs1	A	G	14: 55,739,309	V306A	probably benign	Het
Diaph1	A	T	18: 37,854,573	D1043E	possibly damaging	Het
Dis3	G	T	14: 99,086,103	D538E	probably damaging	Het
Dnaic2	T	G	11: 114,750,380	S344A	probably benign	Het
Dner	C	T	1: 84,445,590	V431M	probably damaging	Het
Dnm1l	A	G	16: 16,342,695		probably null	Het
Eps15	T	G	4: 109,312,918	L139*	probably null	Het
Fam193a	T	A	5: 34,466,292	I55N	possibly damaging	Het
Gm10308	T	A	17: 91,088,957	Y102*	probably null	Het
Gm10509	A	G	17: 21,690,855	K30E	possibly damaging	Het
Gm4778	A	T	3: 94,266,218	M174L	probably benign	Het
Gm9573	A	T	17: 35,619,239		probably benign	Het
Gpr155	T	C	2: 73,367,577	M400V	probably benign	Het
H2-M10.2	T	C	17: 36,286,123		probably benign	Het
Heatr1	G	T	13: 12,396,460	A61S	probably benign	Het
Helb	G	T	10: 120,094,242	T744K	probably damaging	Het
Hmcn1	C	A	1: 150,599,030	W4702L	probably damaging	Het
Hmcn2	C	T	2: 31,396,120	R2095W	probably damaging	Het
Igfbp3	G	C	11: 7,208,461	D267E	probably damaging	Het
Ighmbp2	T	A	19: 3,268,669	H469L	probably damaging	Het
Kcnj3	A	C	2: 55,437,220	K7T	probably damaging	Het
Krtap5-5	T	G	7: 142,229,621	K97N	unknown	Het
Lcor	T	C	19: 41,559,266	S430P	probably benign	Het
Lpin1	A	G	12: 16,538,540	V883A	probably damaging	Het
Lrp1b	T	C	2: 41,110,825	Y2243C	probably damaging	Het
Lrrc46	G	A	11: 97,034,730		probably benign	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Ncbp1	T	A	4: 46,169,131	L635*	probably null	Het
Nipbl	T	C	15: 8,338,551	N1202D	possibly damaging	Het
Nphs1	A	G	7: 30,461,534	D196G	probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1008	A	G	2: 85,690,083	Y218C	probably damaging	Het
Olfr1360	A	G	13: 21,674,695	I83T	probably benign	Het
Olfr901	A	T	9: 38,430,995	I238F	probably benign	Het
Pax8	A	T	2: 24,435,821	N350K	probably damaging	Het
Pik3cd	T	C	4: 149,658,750	K298E	probably benign	Het
Pkd1	C	T	17: 24,594,485	R4000C	probably damaging	Het
Pkn2	A	T	3: 142,810,727	V546D	possibly damaging	Het
Plcg2	A	G	8: 117,592,708	K673E	probably benign	Het
Pld4	T	G	12: 112,763,392		probably null	Het
Plek	A	T	11: 16,992,901	N130K	probably damaging	Het
Prune2	G	A	19: 17,123,704	D2191N	probably benign	Het
Ptgis	T	C	2: 167,206,803	Y431C	probably damaging	Het
Rhbdf2	T	C	11: 116,607,266	S36G	probably benign	Het
Rtn4ip1	C	T	10: 43,910,830	A178V	probably damaging	Het
Rxfp1	A	G	3: 79,670,881	S168P	probably benign	Het
Sec24a	A	G	11: 51,733,763		probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk6	C	T	14: 110,750,552	M574I	probably benign	Het
Slk	T	C	19: 47,622,677	F861L	probably damaging	Het
Smpd3	C	A	8: 106,264,971	A317S	probably benign	Het
Spz1	T	A	13: 92,575,125	Q281L	probably damaging	Het
Syde1	T	A	10: 78,586,980	R519S	probably benign	Het
Taf4	T	C	2: 179,976,531	H39R	unknown	Het
Tbx5	A	T	5: 119,845,113		probably null	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Th	G	A	7: 142,898,166	Q19*	probably null	Het
Tmprss11a	T	A	5: 86,420,179	I230F	probably damaging	Het
Tnfrsf14	T	A	4: 154,925,322	H50L	possibly damaging	Het
Tpp2	T	A	1: 43,978,725		probably null	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim2	A	G	3: 84,190,800	I398T	possibly damaging	Het
Trpc5	A	T	X: 144,481,226	S212T	probably damaging	Het
Ttn	A	G	2: 76,787,334		probably benign	Het
Unc80	A	G	1: 66,639,248	T2063A	possibly damaging	Het
Usp37	A	T	1: 74,479,655	S260T	probably benign	Het
Vcan	A	G	13: 89,691,681	S1915P	probably benign	Het
Vmn1r33	T	A	6: 66,612,298	I91F	possibly damaging	Het
Zfp422	T	C	6: 116,626,424	T205A	probably benign	Het

Other mutations in Apba1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Apba1	APN	19	23917586	missense	possibly damaging	0.95
IGL01991:Apba1	APN	19	23937472	missense	possibly damaging	0.80
IGL02048:Apba1	APN	19	23937636	splice site	probably null
IGL02522:Apba1	APN	19	23912445	splice site	probably benign
IGL02728:Apba1	APN	19	23944905	missense	possibly damaging	0.93
IGL02942:Apba1	APN	19	23944971	missense	possibly damaging	0.78
IGL03349:Apba1	APN	19	23917575	missense	probably benign	0.02
IGL03410:Apba1	APN	19	23937581	missense	possibly damaging	0.67
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0084:Apba1	UTSW	19	23912497	missense	possibly damaging	0.68
R0379:Apba1	UTSW	19	23934830	missense	probably damaging	1.00
R0423:Apba1	UTSW	19	23944998	missense	probably damaging	1.00
R1132:Apba1	UTSW	19	23917553	missense	possibly damaging	0.83
R1291:Apba1	UTSW	19	23917672	missense	probably damaging	0.97
R1681:Apba1	UTSW	19	23936561	missense	probably damaging	1.00
R1714:Apba1	UTSW	19	23944952	missense	possibly damaging	0.67
R1866:Apba1	UTSW	19	23892831	missense	probably benign	0.22
R2076:Apba1	UTSW	19	23893223	nonsense	probably null
R2217:Apba1	UTSW	19	23893962	missense	probably damaging	0.99
R3907:Apba1	UTSW	19	23937506	missense	probably damaging	0.96
R4095:Apba1	UTSW	19	23944024	missense	probably benign	0.00
R4529:Apba1	UTSW	19	23936535	missense	probably damaging	1.00
R4557:Apba1	UTSW	19	23917592	missense	probably damaging	1.00
R4972:Apba1	UTSW	19	23912536	missense	probably benign	0.24
R5521:Apba1	UTSW	19	23893593	missense	probably damaging	1.00
R6539:Apba1	UTSW	19	23936560	missense	probably damaging	1.00
R7032:Apba1	UTSW	19	23912461	missense	probably benign	0.20
R7035:Apba1	UTSW	19	23917567	missense	possibly damaging	0.88
R7495:Apba1	UTSW	19	23936599	critical splice donor site	probably null
R9149:Apba1	UTSW	19	23893418	missense	probably damaging	1.00
R9288:Apba1	UTSW	19	23945781	makesense	probably null
Z1176:Apba1	UTSW	19	23944115	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTCGGGCTACGTCTACACGCAC -3'
(R):5'- CGAACGGATGGTCCTGGTTTTCAC -3'

Sequencing Primer
(F):5'- TCTACACGCACCGGCTC -3'
(R):5'- AATGGCCTCCTTGATGTCC -3'

Posted On

2014-05-23