Mutagenetix > Incidental Mutation

Incidental Mutation 'R1757:Nbea'

194938

Institutional Source

Beutler Lab

Gene Symbol

Nbea

Ensembl Gene

ENSMUSG00000027799

Gene Name

neurobeachin

Synonyms

MMRRC Submission

039789-MU

Accession Numbers

Genbank: NM_030595

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1757 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55625195-56183701 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55630189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 2841 (I2841T)

Ref Sequence

ENSEMBL: ENSMUSP00000029374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029374]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029374
AA Change: I2841T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: I2841T

Domain	Start	End	E-Value	Type
low complexity region	19	40	N/A	INTRINSIC
Pfam:Laminin_G_3	228	393	2.8e-13	PFAM
Pfam:DUF4704	462	733	4e-113	PFAM
low complexity region	792	802	N/A	INTRINSIC
low complexity region	964	969	N/A	INTRINSIC
low complexity region	1781	1790	N/A	INTRINSIC
low complexity region	1791	1807	N/A	INTRINSIC
low complexity region	1835	1845	N/A	INTRINSIC
Pfam:DUF1088	1956	2122	3.5e-91	PFAM
Pfam:PH_BEACH	2148	2245	2.6e-32	PFAM
Beach	2276	2553	1.3e-205	SMART
WD40	2659	2696	2.12e2	SMART
WD40	2699	2742	2.22e0	SMART
WD40	2759	2798	9.21e0	SMART
WD40	2842	2880	2.88e-1	SMART
WD40	2883	2922	8.91e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199803

Meta Mutation Damage Score

0.0925

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

100% (111/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd6	A	T	14: 8,049,867	I219F	probably damaging	Het
Acvr1b	A	G	15: 101,198,822	I207V	possibly damaging	Het
Adamtsl4	T	C	3: 95,677,942	T839A	probably benign	Het
Akap1	C	T	11: 88,845,752	R61H	probably damaging	Het
Akap9	A	G	5: 4,001,667	D1478G	probably benign	Het
Aloxe3	T	A	11: 69,135,949	V547E	possibly damaging	Het
Ano6	G	A	15: 95,962,267	A757T	probably damaging	Het
Armc10	A	G	5: 21,653,457	T167A	probably damaging	Het
BB019430	A	C	10: 58,704,047		noncoding transcript	Het
Brms1	C	T	19: 5,046,407	R82W	probably damaging	Het
Btnl6	G	A	17: 34,514,088	T267I	probably benign	Het
Catsper4	A	T	4: 134,217,901	F215L	probably benign	Het
Ccdc105	T	C	10: 78,747,224	N442S	probably benign	Het
Ccdc188	T	C	16: 18,218,688	F197S	probably damaging	Het
Cers5	A	C	15: 99,736,331	C379G	probably benign	Het
Chchd6	A	G	6: 89,384,644	L259P	probably damaging	Het
Cntnap2	T	A	6: 46,759,829	C730S	probably damaging	Het
Coch	T	G	12: 51,602,848	V314G	probably damaging	Het
Cog1	T	A	11: 113,652,304	S213T	possibly damaging	Het
Crot	A	T	5: 8,987,828	F163I	probably damaging	Het
Cyp4f13	A	T	17: 32,929,958	I162N	probably damaging	Het
Dab2	A	T	15: 6,330,452		probably benign	Het
Depdc1b	C	T	13: 108,323,948	R31W	probably damaging	Het
Dlk1	T	C	12: 109,459,687	F161S	probably damaging	Het
Dnah6	T	C	6: 73,160,982	E913G	probably damaging	Het
Dnajc6	A	G	4: 101,597,831	Y5C	probably damaging	Het
Dock10	T	C	1: 80,533,869	T1508A	probably damaging	Het
Dstyk	A	G	1: 132,434,094		probably benign	Het
Efcc1	T	C	6: 87,749,283		probably benign	Het
Entpd1	T	C	19: 40,739,006	Y533H	probably benign	Het
Epha8	A	T	4: 136,931,478		probably null	Het
Erich3	C	T	3: 154,695,765	T17M	probably damaging	Het
Ethe1	T	C	7: 24,608,474		probably benign	Het
Fbxw15	A	T	9: 109,557,279	M211K	probably damaging	Het
Fhod3	G	A	18: 25,066,278	V669M	possibly damaging	Het
Fktn	C	T	4: 53,747,003		probably benign	Het
Foxred1	G	A	9: 35,210,834	R20C	probably benign	Het
Gbp9	A	G	5: 105,094,453	L140P	probably damaging	Het
Gga1	T	C	15: 78,889,030	L286P	probably damaging	Het
Gm11397	T	C	13: 33,399,353	S150P	probably benign	Het
Gml	T	C	15: 74,813,613		probably benign	Het
Gsap	A	T	5: 21,281,037	K628N	probably damaging	Het
Gtf3c4	G	A	2: 28,830,636		probably benign	Het
H2-M10.6	A	C	17: 36,813,151	Y169S	probably benign	Het
Hal	G	A	10: 93,494,628	V245I	probably benign	Het
Hebp2	T	C	10: 18,545,101	Y72C	probably damaging	Het
Helz2	T	C	2: 181,236,263	E914G	probably damaging	Het
Herc3	T	C	6: 58,916,470	Y906H	probably damaging	Het
Hfm1	A	T	5: 106,880,360		probably null	Het
Hgs	C	T	11: 120,480,063	P582S	probably damaging	Het
Hoxa10	G	A	6: 52,234,489	P149L	probably damaging	Het
Inpp5j	T	A	11: 3,504,738	Q4L	possibly damaging	Het
Ints8	A	C	4: 11,254,109	M1R	probably null	Het
Isg15	T	C	4: 156,199,990	E27G	possibly damaging	Het
Klf13	A	T	7: 63,891,765	C205S	probably damaging	Het
Lama1	G	A	17: 67,697,383	V17M	unknown	Het
Lama1	A	T	17: 67,763,836	Y830F	probably benign	Het
Lama3	A	G	18: 12,465,499	N988D	probably benign	Het
Lcat	CAT	C	8: 105,941,814		probably null	Het
Lct	G	T	1: 128,301,257	P833H	probably damaging	Het
Lmf1	A	T	17: 25,655,210	R403W	probably damaging	Het
Me3	T	G	7: 89,633,022	S38A	probably benign	Het
Myg1	A	T	15: 102,331,829	D30V	probably benign	Het
Nek1	T	A	8: 61,089,813		probably null	Het
Obsl1	C	T	1: 75,493,883	R1043H	probably benign	Het
Olfr1158	T	G	2: 87,990,582	I157R	probably damaging	Het
Olfr1198	G	T	2: 88,746,017	D290E	probably benign	Het
Olfr1475	A	C	19: 13,479,607	V197G	possibly damaging	Het
Olfr430	A	T	1: 174,069,658	Y120F	probably damaging	Het
Osbpl9	A	G	4: 109,064,583	Y613H	probably damaging	Het
Per3	C	T	4: 151,042,792		probably null	Het
Pex6	G	T	17: 46,723,498	V758L	probably damaging	Het
Pikfyve	A	G	1: 65,252,548	I1309V	probably damaging	Het
Pimreg	A	G	11: 72,043,159	E37G	possibly damaging	Het
Pjvk	G	A	2: 76,655,888	V211I	probably benign	Het
Plekhg4	T	A	8: 105,381,661	V1112E	probably damaging	Het
Ptprz1	T	A	6: 23,044,320	M2106K	probably damaging	Het
Rdh16f2	G	T	10: 127,876,896	L254F	probably benign	Het
Rictor	G	A	15: 6,773,862	R485Q	possibly damaging	Het
Rnf146	G	A	10: 29,347,479	T137M	probably damaging	Het
Rrp9	T	A	9: 106,483,004	C204S	probably damaging	Het
Shkbp1	T	C	7: 27,342,351	T693A	probably benign	Het
Skint9	A	G	4: 112,413,962	Y84H	probably benign	Het
Slc22a12	A	T	19: 6,536,731		probably null	Het
Slfn4	T	C	11: 83,185,385	C26R	possibly damaging	Het
Snrnp200	T	C	2: 127,232,443	L1401P	probably damaging	Het
Specc1	T	A	11: 62,119,284		probably null	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Tbc1d22b	A	G	17: 29,571,673	R204G	probably damaging	Het
Tgfbr3l	C	A	8: 4,249,548	D110E	probably benign	Het
Ticrr	C	A	7: 79,679,046	Y644*	probably null	Het
Ticrr	T	G	7: 79,675,323	S532R	probably damaging	Het
Tmem5	T	C	10: 122,089,015	T261A	probably benign	Het
Traf3ip1	A	T	1: 91,522,857	T509S	probably damaging	Het
Trmt10b	T	C	4: 45,307,946	Y209H	probably damaging	Het
Trmt6	T	C	2: 132,810,237	M172V	probably damaging	Het
Tsc1	A	G	2: 28,686,113	D978G	probably benign	Het
Tshz2	C	A	2: 169,883,923	F146L	probably benign	Het
Tspyl4	G	T	10: 34,297,580	E23*	probably null	Het
Ulk2	A	T	11: 61,841,339		probably benign	Het
Umodl1	A	T	17: 31,008,700	I1336F	probably damaging	Het
Vezt	T	C	10: 93,970,563	D662G	probably benign	Het
Vnn1	G	T	10: 23,900,829	Q359H	probably benign	Het
Vnn1	A	T	10: 23,900,828	Q359L	possibly damaging	Het
Zdhhc16	A	G	19: 41,941,955	N14S	probably damaging	Het
Zfp455	T	C	13: 67,207,537	S225P	probably damaging	Het
Zfp74	T	A	7: 29,935,061	E407D	probably benign	Het
Zic2	T	A	14: 122,478,619	H384Q	possibly damaging	Het

Other mutations in Nbea

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Nbea	APN	3	55628493	missense	probably damaging	1.00
IGL00541:Nbea	APN	3	55968089	missense	probably benign	0.02
IGL00584:Nbea	APN	3	56082448	missense	probably damaging	0.98
IGL00648:Nbea	APN	3	56009260	missense	probably damaging	0.98
IGL00785:Nbea	APN	3	55955393	missense	probably benign
IGL00899:Nbea	APN	3	55642845	missense	probably benign	0.32
IGL00955:Nbea	APN	3	56005472	missense	possibly damaging	0.45
IGL01296:Nbea	APN	3	56031536	missense	probably benign	0.04
IGL01299:Nbea	APN	3	55690894	missense	probably damaging	1.00
IGL01393:Nbea	APN	3	56005308	missense	probably benign	0.02
IGL01550:Nbea	APN	3	55805248	missense	possibly damaging	0.93
IGL02023:Nbea	APN	3	55681016	missense	probably damaging	1.00
IGL02034:Nbea	APN	3	55968156	missense	probably damaging	1.00
IGL02061:Nbea	APN	3	55717887	missense	possibly damaging	0.54
IGL02082:Nbea	APN	3	55968167	missense	possibly damaging	0.88
IGL02113:Nbea	APN	3	55992492	missense	probably benign
IGL02188:Nbea	APN	3	55983837	missense	probably benign	0.00
IGL02319:Nbea	APN	3	55985738	missense	probably damaging	1.00
IGL02406:Nbea	APN	3	56086266	missense	probably benign	0.02
IGL02494:Nbea	APN	3	55805351	missense	probably benign	0.02
IGL02550:Nbea	APN	3	56019414	missense	probably damaging	0.98
IGL02706:Nbea	APN	3	56037278	missense	probably damaging	1.00
IGL02718:Nbea	APN	3	55632062	nonsense	probably null
IGL02822:Nbea	APN	3	56019447	missense	possibly damaging	0.93
IGL02885:Nbea	APN	3	55631986	missense	probably benign	0.01
IGL03000:Nbea	APN	3	56004627	missense	possibly damaging	0.94
IGL03081:Nbea	APN	3	56079918	missense	probably damaging	1.00
IGL03091:Nbea	APN	3	56085304	missense	probably damaging	1.00
IGL03368:Nbea	APN	3	56079930	missense	probably damaging	0.98
Neches	UTSW	3	55953034	critical splice donor site	probably null
scotland	UTSW	3	55626908	missense	probably damaging	1.00
Wales	UTSW	3	56091119	missense	probably damaging	1.00
FR4340:Nbea	UTSW	3	56009212	critical splice donor site	probably benign
G4846:Nbea	UTSW	3	56087497	missense	probably damaging	0.98
IGL02835:Nbea	UTSW	3	55717869	missense	possibly damaging	0.88
LCD18:Nbea	UTSW	3	55701527	intron	probably benign
R0087:Nbea	UTSW	3	56091023	missense	possibly damaging	0.92
R0220:Nbea	UTSW	3	56005303	missense	probably benign	0.30
R0324:Nbea	UTSW	3	56057948	critical splice donor site	probably null
R0330:Nbea	UTSW	3	55642817	missense	probably benign	0.27
R0391:Nbea	UTSW	3	56037277	missense	probably damaging	1.00
R0394:Nbea	UTSW	3	56029907	missense	probably damaging	1.00
R0419:Nbea	UTSW	3	55819294	missense	probably benign	0.05
R0503:Nbea	UTSW	3	55642836	missense	possibly damaging	0.79
R0521:Nbea	UTSW	3	56008268	missense	probably damaging	1.00
R0595:Nbea	UTSW	3	55628496	missense	probably benign	0.18
R0894:Nbea	UTSW	3	56009340	missense	possibly damaging	0.89
R1072:Nbea	UTSW	3	56086196	missense	possibly damaging	0.94
R1125:Nbea	UTSW	3	55857006	nonsense	probably null
R1169:Nbea	UTSW	3	55968323	missense	probably benign	0.00
R1241:Nbea	UTSW	3	56058040	missense	probably damaging	1.00
R1269:Nbea	UTSW	3	56004781	missense	probably benign	0.05
R1406:Nbea	UTSW	3	56037281	missense	probably benign	0.00
R1406:Nbea	UTSW	3	56037281	missense	probably benign	0.00
R1457:Nbea	UTSW	3	56085327	missense	probably damaging	1.00
R1482:Nbea	UTSW	3	56079993	missense	probably damaging	1.00
R1483:Nbea	UTSW	3	56002790	missense	probably benign	0.25
R1502:Nbea	UTSW	3	56004889	missense	probably benign	0.03
R1544:Nbea	UTSW	3	56058827	missense	probably damaging	0.99
R1629:Nbea	UTSW	3	56002891	missense	possibly damaging	0.52
R1647:Nbea	UTSW	3	55630229	missense	probably damaging	0.97
R1663:Nbea	UTSW	3	55645986	missense	possibly damaging	0.95
R1722:Nbea	UTSW	3	55665695	missense	probably damaging	1.00
R1771:Nbea	UTSW	3	55934519	missense	probably benign	0.00
R1796:Nbea	UTSW	3	55643708	missense	possibly damaging	0.48
R1844:Nbea	UTSW	3	56082436	missense	probably damaging	0.97
R1872:Nbea	UTSW	3	55642889	missense	probably benign	0.12
R1938:Nbea	UTSW	3	56085322	missense	probably damaging	1.00
R1940:Nbea	UTSW	3	55953100	missense	possibly damaging	0.78
R2062:Nbea	UTSW	3	56086157	splice site	probably benign
R2066:Nbea	UTSW	3	55968146	missense	probably damaging	1.00
R2097:Nbea	UTSW	3	55723217	missense	probably damaging	0.96
R2181:Nbea	UTSW	3	56029939	missense	possibly damaging	0.92
R2274:Nbea	UTSW	3	55988085	splice site	probably null
R2345:Nbea	UTSW	3	56085279	missense	probably damaging	1.00
R2423:Nbea	UTSW	3	56085306	missense	probably damaging	1.00
R2434:Nbea	UTSW	3	55647460	missense	possibly damaging	0.91
R2880:Nbea	UTSW	3	55647358	missense	probably benign	0.04
R2881:Nbea	UTSW	3	55647358	missense	probably benign	0.04
R2940:Nbea	UTSW	3	55934624	missense	probably benign	0.24
R3500:Nbea	UTSW	3	55681010	missense	possibly damaging	0.88
R3765:Nbea	UTSW	3	56005549	missense	probably damaging	1.00
R3790:Nbea	UTSW	3	56005029	missense	probably benign
R3808:Nbea	UTSW	3	55717848	missense	probably benign	0.02
R3845:Nbea	UTSW	3	56086292	splice site	probably benign
R4182:Nbea	UTSW	3	56008427	missense	probably damaging	0.99
R4385:Nbea	UTSW	3	56000638	missense	possibly damaging	0.77
R4419:Nbea	UTSW	3	56009600	missense	probably damaging	1.00
R4426:Nbea	UTSW	3	56082379	missense	probably damaging	0.98
R4451:Nbea	UTSW	3	55992332	critical splice donor site	probably null
R4456:Nbea	UTSW	3	55643784	missense	probably benign	0.00
R4604:Nbea	UTSW	3	55723648	missense	probably benign	0.18
R4687:Nbea	UTSW	3	56058065	missense	probably damaging	1.00
R4758:Nbea	UTSW	3	56005403	missense	probably benign
R4840:Nbea	UTSW	3	55710670	missense	probably benign	0.37
R4888:Nbea	UTSW	3	56005355	missense	possibly damaging	0.61
R4954:Nbea	UTSW	3	56035958	missense	probably damaging	1.00
R4972:Nbea	UTSW	3	56085246	missense	probably damaging	0.99
R4980:Nbea	UTSW	3	55647351	splice site	probably null
R4980:Nbea	UTSW	3	55953045	missense	probably benign	0.00
R5104:Nbea	UTSW	3	56079927	missense	probably damaging	1.00
R5139:Nbea	UTSW	3	55626963	missense	possibly damaging	0.90
R5166:Nbea	UTSW	3	56019453	missense	probably damaging	1.00
R5347:Nbea	UTSW	3	56040876	missense	probably damaging	1.00
R5350:Nbea	UTSW	3	56019424	missense	probably damaging	1.00
R5418:Nbea	UTSW	3	55645989	missense	possibly damaging	0.86
R5586:Nbea	UTSW	3	55631971	missense	probably benign	0.08
R5627:Nbea	UTSW	3	55992345	missense	probably damaging	1.00
R5683:Nbea	UTSW	3	55628586	missense	possibly damaging	0.53
R5765:Nbea	UTSW	3	56005298	missense	probably benign	0.15
R5853:Nbea	UTSW	3	55992401	missense	probably damaging	1.00
R5858:Nbea	UTSW	3	55953034	critical splice donor site	probably null
R5955:Nbea	UTSW	3	55680983	missense	probably benign	0.00
R5976:Nbea	UTSW	3	55853847	missense	probably benign	0.30
R6039:Nbea	UTSW	3	56005117	missense	probably benign	0.00
R6039:Nbea	UTSW	3	56005117	missense	probably benign	0.00
R6043:Nbea	UTSW	3	55786475	missense	probably benign	0.32
R6122:Nbea	UTSW	3	56029896	missense	probably damaging	1.00
R6218:Nbea	UTSW	3	55628484	missense	probably damaging	0.97
R6331:Nbea	UTSW	3	56000616	missense	possibly damaging	0.94
R6334:Nbea	UTSW	3	56037149	missense	probably damaging	1.00
R6393:Nbea	UTSW	3	56091119	missense	probably damaging	1.00
R6411:Nbea	UTSW	3	55805357	missense	probably benign	0.01
R6457:Nbea	UTSW	3	56000569	missense	probably damaging	1.00
R6476:Nbea	UTSW	3	56004806	missense	probably benign	0.00
R6488:Nbea	UTSW	3	55717843	missense	probably damaging	0.99
R6700:Nbea	UTSW	3	56082448	missense	possibly damaging	0.89
R6702:Nbea	UTSW	3	56005502	missense	probably benign	0.06
R6752:Nbea	UTSW	3	55968309	missense	probably benign	0.02
R6752:Nbea	UTSW	3	56037219	missense	probably benign
R6804:Nbea	UTSW	3	56087453	missense	probably benign	0.37
R6901:Nbea	UTSW	3	56019415	missense	probably damaging	1.00
R6933:Nbea	UTSW	3	55723610	missense	possibly damaging	0.63
R7124:Nbea	UTSW	3	55992444	missense	probably damaging	1.00
R7211:Nbea	UTSW	3	56004901	missense	probably benign	0.05
R7308:Nbea	UTSW	3	56091031	missense	probably damaging	1.00
R7405:Nbea	UTSW	3	55805266	missense	possibly damaging	0.94
R7669:Nbea	UTSW	3	55717779	missense	probably damaging	1.00
R7762:Nbea	UTSW	3	55649705	missense	probably damaging	1.00
R7833:Nbea	UTSW	3	56002797	missense	probably damaging	1.00
R7885:Nbea	UTSW	3	55665689	missense	probably damaging	0.97
R7935:Nbea	UTSW	3	56058665	missense	probably damaging	1.00
R8050:Nbea	UTSW	3	55987981	missense	probably damaging	0.99
R8108:Nbea	UTSW	3	55819315	missense	probably benign	0.11
R8290:Nbea	UTSW	3	56058635	nonsense	probably null
R8314:Nbea	UTSW	3	56009251	missense	probably damaging	0.99
R8321:Nbea	UTSW	3	56183097	missense	possibly damaging	0.86
R8376:Nbea	UTSW	3	55643655	missense	possibly damaging	0.79
R8410:Nbea	UTSW	3	56037263	missense	probably damaging	1.00
R8556:Nbea	UTSW	3	55647386	missense	probably benign	0.25
R8753:Nbea	UTSW	3	55626908	missense	probably damaging	1.00
R8844:Nbea	UTSW	3	56090994	missense	probably damaging	0.97
R8884:Nbea	UTSW	3	55805299	missense	probably benign	0.00
R8886:Nbea	UTSW	3	56058727	missense	probably damaging	1.00
R8890:Nbea	UTSW	3	56019363	splice site	probably benign
R9004:Nbea	UTSW	3	56002938	missense	probably benign	0.01
R9022:Nbea	UTSW	3	55643689	missense	possibly damaging	0.79
R9080:Nbea	UTSW	3	56005095	nonsense	probably null
R9087:Nbea	UTSW	3	55642736	critical splice donor site	probably null
R9104:Nbea	UTSW	3	55955388	missense	probably benign
R9165:Nbea	UTSW	3	56004868	missense	probably benign	0.15
R9219:Nbea	UTSW	3	56090972	frame shift	probably null
R9221:Nbea	UTSW	3	56090972	frame shift	probably null
R9222:Nbea	UTSW	3	56090972	frame shift	probably null
R9260:Nbea	UTSW	3	55983812	missense	possibly damaging	0.50
R9263:Nbea	UTSW	3	56090972	frame shift	probably null
R9265:Nbea	UTSW	3	56090972	frame shift	probably null
R9294:Nbea	UTSW	3	56091092	missense	probably benign	0.00
R9360:Nbea	UTSW	3	56035898	missense	possibly damaging	0.96
R9387:Nbea	UTSW	3	55991039	missense	probably benign	0.12
R9428:Nbea	UTSW	3	56090972	frame shift	probably null
R9435:Nbea	UTSW	3	56035888	missense	possibly damaging	0.63
R9507:Nbea	UTSW	3	55665590	missense	probably damaging	1.00
R9514:Nbea	UTSW	3	56029945	missense	probably damaging	1.00
R9516:Nbea	UTSW	3	56029945	missense	probably damaging	1.00
R9674:Nbea	UTSW	3	56058762	missense	probably damaging	1.00
R9688:Nbea	UTSW	3	55649744	missense	probably benign	0.42
R9709:Nbea	UTSW	3	55786458	nonsense	probably null
RF051:Nbea	UTSW	3	56009212	critical splice donor site	probably benign
X0018:Nbea	UTSW	3	56036048	missense	probably benign	0.39
Z1088:Nbea	UTSW	3	55723163	missense	probably benign	0.34
Z1177:Nbea	UTSW	3	56031550	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATGTTCTCCTTTAGGCCAACAGC -3'
(R):5'- GGGAGTCGTTCAAACTTTGGAGCAC -3'

Sequencing Primer
(F):5'- CCGAGCCATTTGATGTCAAG -3'
(R):5'- gtgtgtaggtgtgtaggtgtag -3'

Posted On

2014-05-23