Incidental Mutation 'R1757:Dnah6'
ID194960
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Namedynein, axonemal, heavy chain 6
SynonymsA730004I20Rik, Dnahc6
MMRRC Submission 039789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1757 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location73017606-73221651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73160982 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 913 (E913G)
Ref Sequence ENSEMBL: ENSMUSP00000109674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064948
AA Change: E913G

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: E913G

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114040
AA Change: E913G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: E913G

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204053
AA Change: E913G

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: E913G

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Meta Mutation Damage Score 0.1433 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 I219F probably damaging Het
Acvr1b A G 15: 101,198,822 I207V possibly damaging Het
Adamtsl4 T C 3: 95,677,942 T839A probably benign Het
Akap1 C T 11: 88,845,752 R61H probably damaging Het
Akap9 A G 5: 4,001,667 D1478G probably benign Het
Aloxe3 T A 11: 69,135,949 V547E possibly damaging Het
Ano6 G A 15: 95,962,267 A757T probably damaging Het
Armc10 A G 5: 21,653,457 T167A probably damaging Het
BB019430 A C 10: 58,704,047 noncoding transcript Het
Brms1 C T 19: 5,046,407 R82W probably damaging Het
Btnl6 G A 17: 34,514,088 T267I probably benign Het
Catsper4 A T 4: 134,217,901 F215L probably benign Het
Ccdc105 T C 10: 78,747,224 N442S probably benign Het
Ccdc188 T C 16: 18,218,688 F197S probably damaging Het
Cers5 A C 15: 99,736,331 C379G probably benign Het
Chchd6 A G 6: 89,384,644 L259P probably damaging Het
Cntnap2 T A 6: 46,759,829 C730S probably damaging Het
Coch T G 12: 51,602,848 V314G probably damaging Het
Cog1 T A 11: 113,652,304 S213T possibly damaging Het
Crot A T 5: 8,987,828 F163I probably damaging Het
Cyp4f13 A T 17: 32,929,958 I162N probably damaging Het
Dab2 A T 15: 6,330,452 probably benign Het
Depdc1b C T 13: 108,323,948 R31W probably damaging Het
Dlk1 T C 12: 109,459,687 F161S probably damaging Het
Dnajc6 A G 4: 101,597,831 Y5C probably damaging Het
Dock10 T C 1: 80,533,869 T1508A probably damaging Het
Dstyk A G 1: 132,434,094 probably benign Het
Efcc1 T C 6: 87,749,283 probably benign Het
Entpd1 T C 19: 40,739,006 Y533H probably benign Het
Epha8 A T 4: 136,931,478 probably null Het
Erich3 C T 3: 154,695,765 T17M probably damaging Het
Ethe1 T C 7: 24,608,474 probably benign Het
Fbxw15 A T 9: 109,557,279 M211K probably damaging Het
Fhod3 G A 18: 25,066,278 V669M possibly damaging Het
Fktn C T 4: 53,747,003 probably benign Het
Foxred1 G A 9: 35,210,834 R20C probably benign Het
Gbp9 A G 5: 105,094,453 L140P probably damaging Het
Gga1 T C 15: 78,889,030 L286P probably damaging Het
Gm11397 T C 13: 33,399,353 S150P probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gsap A T 5: 21,281,037 K628N probably damaging Het
Gtf3c4 G A 2: 28,830,636 probably benign Het
H2-M10.6 A C 17: 36,813,151 Y169S probably benign Het
Hal G A 10: 93,494,628 V245I probably benign Het
Hebp2 T C 10: 18,545,101 Y72C probably damaging Het
Helz2 T C 2: 181,236,263 E914G probably damaging Het
Herc3 T C 6: 58,916,470 Y906H probably damaging Het
Hfm1 A T 5: 106,880,360 probably null Het
Hgs C T 11: 120,480,063 P582S probably damaging Het
Hoxa10 G A 6: 52,234,489 P149L probably damaging Het
Inpp5j T A 11: 3,504,738 Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 M1R probably null Het
Isg15 T C 4: 156,199,990 E27G possibly damaging Het
Klf13 A T 7: 63,891,765 C205S probably damaging Het
Lama1 G A 17: 67,697,383 V17M unknown Het
Lama1 A T 17: 67,763,836 Y830F probably benign Het
Lama3 A G 18: 12,465,499 N988D probably benign Het
Lcat CAT C 8: 105,941,814 probably null Het
Lct G T 1: 128,301,257 P833H probably damaging Het
Lmf1 A T 17: 25,655,210 R403W probably damaging Het
Me3 T G 7: 89,633,022 S38A probably benign Het
Myg1 A T 15: 102,331,829 D30V probably benign Het
Nbea A G 3: 55,630,189 I2841T possibly damaging Het
Nek1 T A 8: 61,089,813 probably null Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr1158 T G 2: 87,990,582 I157R probably damaging Het
Olfr1198 G T 2: 88,746,017 D290E probably benign Het
Olfr1475 A C 19: 13,479,607 V197G possibly damaging Het
Olfr430 A T 1: 174,069,658 Y120F probably damaging Het
Osbpl9 A G 4: 109,064,583 Y613H probably damaging Het
Per3 C T 4: 151,042,792 probably null Het
Pex6 G T 17: 46,723,498 V758L probably damaging Het
Pikfyve A G 1: 65,252,548 I1309V probably damaging Het
Pimreg A G 11: 72,043,159 E37G possibly damaging Het
Pjvk G A 2: 76,655,888 V211I probably benign Het
Plekhg4 T A 8: 105,381,661 V1112E probably damaging Het
Ptprz1 T A 6: 23,044,320 M2106K probably damaging Het
Rdh16f2 G T 10: 127,876,896 L254F probably benign Het
Rictor G A 15: 6,773,862 R485Q possibly damaging Het
Rnf146 G A 10: 29,347,479 T137M probably damaging Het
Rrp9 T A 9: 106,483,004 C204S probably damaging Het
Shkbp1 T C 7: 27,342,351 T693A probably benign Het
Skint9 A G 4: 112,413,962 Y84H probably benign Het
Slc22a12 A T 19: 6,536,731 probably null Het
Slfn4 T C 11: 83,185,385 C26R possibly damaging Het
Snrnp200 T C 2: 127,232,443 L1401P probably damaging Het
Specc1 T A 11: 62,119,284 probably null Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Tbc1d22b A G 17: 29,571,673 R204G probably damaging Het
Tgfbr3l C A 8: 4,249,548 D110E probably benign Het
Ticrr T G 7: 79,675,323 S532R probably damaging Het
Ticrr C A 7: 79,679,046 Y644* probably null Het
Tmem5 T C 10: 122,089,015 T261A probably benign Het
Traf3ip1 A T 1: 91,522,857 T509S probably damaging Het
Trmt10b T C 4: 45,307,946 Y209H probably damaging Het
Trmt6 T C 2: 132,810,237 M172V probably damaging Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Tshz2 C A 2: 169,883,923 F146L probably benign Het
Tspyl4 G T 10: 34,297,580 E23* probably null Het
Ulk2 A T 11: 61,841,339 probably benign Het
Umodl1 A T 17: 31,008,700 I1336F probably damaging Het
Vezt T C 10: 93,970,563 D662G probably benign Het
Vnn1 A T 10: 23,900,828 Q359L possibly damaging Het
Vnn1 G T 10: 23,900,829 Q359H probably benign Het
Zdhhc16 A G 19: 41,941,955 N14S probably damaging Het
Zfp455 T C 13: 67,207,537 S225P probably damaging Het
Zfp74 T A 7: 29,935,061 E407D probably benign Het
Zic2 T A 14: 122,478,619 H384Q possibly damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 intron probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 intron probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7203:Dnah6 UTSW 6 73173545 missense probably benign 0.00
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7387:Dnah6 UTSW 6 73212612 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGCATCAGCATCTTGGCACTAC -3'
(R):5'- ACTGCACTTGATAGCGAAGCAGAC -3'

Sequencing Primer
(F):5'- TTGTCTATCATGTAACAGACCCCAAG -3'
(R):5'- CTTGATAGCGAAGCAGACAATGC -3'
Posted On2014-05-23