Incidental Mutation 'R1757:Ticrr'
ID 194969
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 039789-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R1757 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 79328794 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 644 (Y644*)
Ref Sequence ENSEMBL: ENSMUSP00000146155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably null
Transcript: ENSMUST00000035977
AA Change: Y644*
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: Y644*

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206072
Predicted Effect probably null
Transcript: ENSMUST00000206591
AA Change: Y644*
Predicted Effect probably null
Transcript: ENSMUST00000206622
AA Change: Y644*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206677
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 (GRCm38) I219F probably damaging Het
Acvr1b A G 15: 101,096,703 (GRCm39) I207V possibly damaging Het
Adamtsl4 T C 3: 95,585,252 (GRCm39) T839A probably benign Het
Akap1 C T 11: 88,736,578 (GRCm39) R61H probably damaging Het
Akap9 A G 5: 4,051,667 (GRCm39) D1478G probably benign Het
Aloxe3 T A 11: 69,026,775 (GRCm39) V547E possibly damaging Het
Ano6 G A 15: 95,860,148 (GRCm39) A757T probably damaging Het
Armc10 A G 5: 21,858,455 (GRCm39) T167A probably damaging Het
BB019430 A C 10: 58,539,869 (GRCm39) noncoding transcript Het
Brms1 C T 19: 5,096,435 (GRCm39) R82W probably damaging Het
Btnl6 G A 17: 34,733,062 (GRCm39) T267I probably benign Het
Catsper4 A T 4: 133,945,212 (GRCm39) F215L probably benign Het
Ccdc188 T C 16: 18,036,552 (GRCm39) F197S probably damaging Het
Cers5 A C 15: 99,634,212 (GRCm39) C379G probably benign Het
Chchd6 A G 6: 89,361,626 (GRCm39) L259P probably damaging Het
Cntnap2 T A 6: 46,736,763 (GRCm39) C730S probably damaging Het
Coch T G 12: 51,649,631 (GRCm39) V314G probably damaging Het
Cog1 T A 11: 113,543,130 (GRCm39) S213T possibly damaging Het
Crot A T 5: 9,037,828 (GRCm39) F163I probably damaging Het
Cyp4f13 A T 17: 33,148,932 (GRCm39) I162N probably damaging Het
Dab2 A T 15: 6,359,933 (GRCm39) probably benign Het
Depdc1b C T 13: 108,460,482 (GRCm39) R31W probably damaging Het
Dlk1 T C 12: 109,425,613 (GRCm39) F161S probably damaging Het
Dnah6 T C 6: 73,137,965 (GRCm39) E913G probably damaging Het
Dnajc6 A G 4: 101,455,028 (GRCm39) Y5C probably damaging Het
Dock10 T C 1: 80,511,586 (GRCm39) T1508A probably damaging Het
Dstyk A G 1: 132,361,832 (GRCm39) probably benign Het
Efcc1 T C 6: 87,726,265 (GRCm39) probably benign Het
Entpd1 T C 19: 40,727,450 (GRCm39) Y533H probably benign Het
Epha8 A T 4: 136,658,789 (GRCm39) probably null Het
Erich3 C T 3: 154,401,402 (GRCm39) T17M probably damaging Het
Ethe1 T C 7: 24,307,899 (GRCm39) probably benign Het
Fbxw15 A T 9: 109,386,347 (GRCm39) M211K probably damaging Het
Fhod3 G A 18: 25,199,335 (GRCm39) V669M possibly damaging Het
Fktn C T 4: 53,747,003 (GRCm39) probably benign Het
Foxred1 G A 9: 35,122,130 (GRCm39) R20C probably benign Het
Gbp9 A G 5: 105,242,319 (GRCm39) L140P probably damaging Het
Gga1 T C 15: 78,773,230 (GRCm39) L286P probably damaging Het
Gml T C 15: 74,685,462 (GRCm39) probably benign Het
Gsap A T 5: 21,486,035 (GRCm39) K628N probably damaging Het
Gtf3c4 G A 2: 28,720,648 (GRCm39) probably benign Het
H2-M10.6 A C 17: 37,124,043 (GRCm39) Y169S probably benign Het
Hal G A 10: 93,330,490 (GRCm39) V245I probably benign Het
Hebp2 T C 10: 18,420,849 (GRCm39) Y72C probably damaging Het
Helz2 T C 2: 180,878,056 (GRCm39) E914G probably damaging Het
Herc3 T C 6: 58,893,455 (GRCm39) Y906H probably damaging Het
Hfm1 A T 5: 107,028,226 (GRCm39) probably null Het
Hgs C T 11: 120,370,889 (GRCm39) P582S probably damaging Het
Hoxa10 G A 6: 52,211,469 (GRCm39) P149L probably damaging Het
Inpp5j T A 11: 3,454,738 (GRCm39) Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 (GRCm39) M1R probably null Het
Isg15 T C 4: 156,284,447 (GRCm39) E27G possibly damaging Het
Klf13 A T 7: 63,541,513 (GRCm39) C205S probably damaging Het
Lama1 A T 17: 68,070,831 (GRCm39) Y830F probably benign Het
Lama1 G A 17: 68,004,378 (GRCm39) V17M unknown Het
Lama3 A G 18: 12,598,556 (GRCm39) N988D probably benign Het
Lcat CAT C 8: 106,668,446 (GRCm39) probably null Het
Lct G T 1: 128,228,994 (GRCm39) P833H probably damaging Het
Lmf1 A T 17: 25,874,184 (GRCm39) R403W probably damaging Het
Me3 T G 7: 89,282,230 (GRCm39) S38A probably benign Het
Myg1 A T 15: 102,240,264 (GRCm39) D30V probably benign Het
Nbea A G 3: 55,537,610 (GRCm39) I2841T possibly damaging Het
Nek1 T A 8: 61,542,847 (GRCm39) probably null Het
Obsl1 C T 1: 75,470,527 (GRCm39) R1043H probably benign Het
Or4p23 G T 2: 88,576,361 (GRCm39) D290E probably benign Het
Or5b119 A C 19: 13,456,971 (GRCm39) V197G possibly damaging Het
Or6n2 A T 1: 173,897,224 (GRCm39) Y120F probably damaging Het
Or9m2 T G 2: 87,820,926 (GRCm39) I157R probably damaging Het
Osbpl9 A G 4: 108,921,780 (GRCm39) Y613H probably damaging Het
Per3 C T 4: 151,127,249 (GRCm39) probably null Het
Pex6 G T 17: 47,034,424 (GRCm39) V758L probably damaging Het
Pikfyve A G 1: 65,291,707 (GRCm39) I1309V probably damaging Het
Pimreg A G 11: 71,933,985 (GRCm39) E37G possibly damaging Het
Pjvk G A 2: 76,486,232 (GRCm39) V211I probably benign Het
Plekhg4 T A 8: 106,108,293 (GRCm39) V1112E probably damaging Het
Ptprz1 T A 6: 23,044,319 (GRCm39) M2106K probably damaging Het
Rdh16f2 G T 10: 127,712,765 (GRCm39) L254F probably benign Het
Rictor G A 15: 6,803,343 (GRCm39) R485Q possibly damaging Het
Rnf146 G A 10: 29,223,475 (GRCm39) T137M probably damaging Het
Rrp9 T A 9: 106,360,203 (GRCm39) C204S probably damaging Het
Rxylt1 T C 10: 121,924,920 (GRCm39) T261A probably benign Het
Serpinb9h T C 13: 33,583,336 (GRCm39) S150P probably benign Het
Shkbp1 T C 7: 27,041,776 (GRCm39) T693A probably benign Het
Skint9 A G 4: 112,271,159 (GRCm39) Y84H probably benign Het
Slc22a12 A T 19: 6,586,761 (GRCm39) probably null Het
Slfn4 T C 11: 83,076,211 (GRCm39) C26R possibly damaging Het
Snrnp200 T C 2: 127,074,363 (GRCm39) L1401P probably damaging Het
Specc1 T A 11: 62,010,110 (GRCm39) probably null Het
Spef2 A T 15: 9,717,568 (GRCm39) M316K probably damaging Het
Tbc1d22b A G 17: 29,790,647 (GRCm39) R204G probably damaging Het
Tektl1 T C 10: 78,583,058 (GRCm39) N442S probably benign Het
Tgfbr3l C A 8: 4,299,548 (GRCm39) D110E probably benign Het
Traf3ip1 A T 1: 91,450,579 (GRCm39) T509S probably damaging Het
Trmt10b T C 4: 45,307,946 (GRCm39) Y209H probably damaging Het
Trmt6 T C 2: 132,652,157 (GRCm39) M172V probably damaging Het
Tsc1 A G 2: 28,576,125 (GRCm39) D978G probably benign Het
Tshz2 C A 2: 169,725,843 (GRCm39) F146L probably benign Het
Tspyl4 G T 10: 34,173,576 (GRCm39) E23* probably null Het
Ulk2 A T 11: 61,732,165 (GRCm39) probably benign Het
Umodl1 A T 17: 31,227,674 (GRCm39) I1336F probably damaging Het
Vezt T C 10: 93,806,425 (GRCm39) D662G probably benign Het
Vnn1 G T 10: 23,776,727 (GRCm39) Q359H probably benign Het
Vnn1 A T 10: 23,776,726 (GRCm39) Q359L possibly damaging Het
Zdhhc16 A G 19: 41,930,394 (GRCm39) N14S probably damaging Het
Zfp455 T C 13: 67,355,601 (GRCm39) S225P probably damaging Het
Zfp74 T A 7: 29,634,486 (GRCm39) E407D probably benign Het
Zic2 T A 14: 122,716,031 (GRCm39) H384Q possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCAGTCACGGCCATCCAGACATAG -3'
(R):5'- GCAGTGTCATTGGACAGAAGTCCAC -3'

Sequencing Primer
(F):5'- gccatccagacatagatttctcc -3'
(R):5'- caaagagggcagaagaggg -3'
Posted On 2014-05-23