Incidental Mutation 'R1757:Rrp9'
ID194976
Institutional Source Beutler Lab
Gene Symbol Rrp9
Ensembl Gene ENSMUSG00000041506
Gene NameRRP9, small subunit (SSU) processome component, homolog (yeast)
SynonymsRnu3ip2, U3-55k, 55kDa, D9Wsu10e
MMRRC Submission 039789-MU
Accession Numbers

NCBI RefSeq: NM_145620.4; MGI: 2384313

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1757 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106475963-106485424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106483004 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 204 (C204S)
Ref Sequence ENSEMBL: ENSMUSP00000038580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047721] [ENSMUST00000185336]
Predicted Effect probably damaging
Transcript: ENSMUST00000047721
AA Change: C204S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038580
Gene: ENSMUSG00000041506
AA Change: C204S

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
coiled coil region 61 102 N/A INTRINSIC
WD40 135 174 1.15e-4 SMART
WD40 177 227 3.09e-5 SMART
WD40 230 269 2.42e-7 SMART
WD40 272 311 9.24e-4 SMART
WD40 313 351 2.4e-2 SMART
WD40 354 404 4.6e0 SMART
Blast:WD40 412 451 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156796
Predicted Effect probably benign
Transcript: ENSMUST00000185336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217303
Meta Mutation Damage Score 0.3798 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-repeat protein family. The encoded protein is a component of the nucleolar small nuclear ribonucleoprotein particle (snoRNP) and is essential for 18s rRNA processing during ribosome synthesis. It contains seven WD domains required for nucleolar localization and specific interaction with the U3 small nucleolar RNA (U3 snoRNA). [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)  

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 I219F probably damaging Het
Acvr1b A G 15: 101,198,822 I207V possibly damaging Het
Adamtsl4 T C 3: 95,677,942 T839A probably benign Het
Akap1 C T 11: 88,845,752 R61H probably damaging Het
Akap9 A G 5: 4,001,667 D1478G probably benign Het
Aloxe3 T A 11: 69,135,949 V547E possibly damaging Het
Ano6 G A 15: 95,962,267 A757T probably damaging Het
Armc10 A G 5: 21,653,457 T167A probably damaging Het
BB019430 A C 10: 58,704,047 noncoding transcript Het
Brms1 C T 19: 5,046,407 R82W probably damaging Het
Btnl6 G A 17: 34,514,088 T267I probably benign Het
Catsper4 A T 4: 134,217,901 F215L probably benign Het
Ccdc105 T C 10: 78,747,224 N442S probably benign Het
Ccdc188 T C 16: 18,218,688 F197S probably damaging Het
Cers5 A C 15: 99,736,331 C379G probably benign Het
Chchd6 A G 6: 89,384,644 L259P probably damaging Het
Cntnap2 T A 6: 46,759,829 C730S probably damaging Het
Coch T G 12: 51,602,848 V314G probably damaging Het
Cog1 T A 11: 113,652,304 S213T possibly damaging Het
Crot A T 5: 8,987,828 F163I probably damaging Het
Cyp4f13 A T 17: 32,929,958 I162N probably damaging Het
Dab2 A T 15: 6,330,452 probably benign Het
Depdc1b C T 13: 108,323,948 R31W probably damaging Het
Dlk1 T C 12: 109,459,687 F161S probably damaging Het
Dnah6 T C 6: 73,160,982 E913G probably damaging Het
Dnajc6 A G 4: 101,597,831 Y5C probably damaging Het
Dock10 T C 1: 80,533,869 T1508A probably damaging Het
Dstyk A G 1: 132,434,094 probably benign Het
Efcc1 T C 6: 87,749,283 probably benign Het
Entpd1 T C 19: 40,739,006 Y533H probably benign Het
Epha8 A T 4: 136,931,478 probably null Het
Erich3 C T 3: 154,695,765 T17M probably damaging Het
Ethe1 T C 7: 24,608,474 probably benign Het
Fbxw15 A T 9: 109,557,279 M211K probably damaging Het
Fhod3 G A 18: 25,066,278 V669M possibly damaging Het
Fktn C T 4: 53,747,003 probably benign Het
Foxred1 G A 9: 35,210,834 R20C probably benign Het
Gbp9 A G 5: 105,094,453 L140P probably damaging Het
Gga1 T C 15: 78,889,030 L286P probably damaging Het
Gm11397 T C 13: 33,399,353 S150P probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gsap A T 5: 21,281,037 K628N probably damaging Het
Gtf3c4 G A 2: 28,830,636 probably benign Het
H2-M10.6 A C 17: 36,813,151 Y169S probably benign Het
Hal G A 10: 93,494,628 V245I probably benign Het
Hebp2 T C 10: 18,545,101 Y72C probably damaging Het
Helz2 T C 2: 181,236,263 E914G probably damaging Het
Herc3 T C 6: 58,916,470 Y906H probably damaging Het
Hfm1 A T 5: 106,880,360 probably null Het
Hgs C T 11: 120,480,063 P582S probably damaging Het
Hoxa10 G A 6: 52,234,489 P149L probably damaging Het
Inpp5j T A 11: 3,504,738 Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 M1R probably null Het
Isg15 T C 4: 156,199,990 E27G possibly damaging Het
Klf13 A T 7: 63,891,765 C205S probably damaging Het
Lama1 G A 17: 67,697,383 V17M unknown Het
Lama1 A T 17: 67,763,836 Y830F probably benign Het
Lama3 A G 18: 12,465,499 N988D probably benign Het
Lcat CAT C 8: 105,941,814 probably null Het
Lct G T 1: 128,301,257 P833H probably damaging Het
Lmf1 A T 17: 25,655,210 R403W probably damaging Het
Me3 T G 7: 89,633,022 S38A probably benign Het
Myg1 A T 15: 102,331,829 D30V probably benign Het
Nbea A G 3: 55,630,189 I2841T possibly damaging Het
Nek1 T A 8: 61,089,813 probably null Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr1158 T G 2: 87,990,582 I157R probably damaging Het
Olfr1198 G T 2: 88,746,017 D290E probably benign Het
Olfr1475 A C 19: 13,479,607 V197G possibly damaging Het
Olfr430 A T 1: 174,069,658 Y120F probably damaging Het
Osbpl9 A G 4: 109,064,583 Y613H probably damaging Het
Per3 C T 4: 151,042,792 probably null Het
Pex6 G T 17: 46,723,498 V758L probably damaging Het
Pikfyve A G 1: 65,252,548 I1309V probably damaging Het
Pimreg A G 11: 72,043,159 E37G possibly damaging Het
Pjvk G A 2: 76,655,888 V211I probably benign Het
Plekhg4 T A 8: 105,381,661 V1112E probably damaging Het
Ptprz1 T A 6: 23,044,320 M2106K probably damaging Het
Rdh16f2 G T 10: 127,876,896 L254F probably benign Het
Rictor G A 15: 6,773,862 R485Q possibly damaging Het
Rnf146 G A 10: 29,347,479 T137M probably damaging Het
Shkbp1 T C 7: 27,342,351 T693A probably benign Het
Skint9 A G 4: 112,413,962 Y84H probably benign Het
Slc22a12 A T 19: 6,536,731 probably null Het
Slfn4 T C 11: 83,185,385 C26R possibly damaging Het
Snrnp200 T C 2: 127,232,443 L1401P probably damaging Het
Specc1 T A 11: 62,119,284 probably null Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Tbc1d22b A G 17: 29,571,673 R204G probably damaging Het
Tgfbr3l C A 8: 4,249,548 D110E probably benign Het
Ticrr T G 7: 79,675,323 S532R probably damaging Het
Ticrr C A 7: 79,679,046 Y644* probably null Het
Tmem5 T C 10: 122,089,015 T261A probably benign Het
Traf3ip1 A T 1: 91,522,857 T509S probably damaging Het
Trmt10b T C 4: 45,307,946 Y209H probably damaging Het
Trmt6 T C 2: 132,810,237 M172V probably damaging Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Tshz2 C A 2: 169,883,923 F146L probably benign Het
Tspyl4 G T 10: 34,297,580 E23* probably null Het
Ulk2 A T 11: 61,841,339 probably benign Het
Umodl1 A T 17: 31,008,700 I1336F probably damaging Het
Vezt T C 10: 93,970,563 D662G probably benign Het
Vnn1 A T 10: 23,900,828 Q359L possibly damaging Het
Vnn1 G T 10: 23,900,829 Q359H probably benign Het
Zdhhc16 A G 19: 41,941,955 N14S probably damaging Het
Zfp455 T C 13: 67,207,537 S225P probably damaging Het
Zfp74 T A 7: 29,935,061 E407D probably benign Het
Zic2 T A 14: 122,478,619 H384Q possibly damaging Het
Other mutations in Rrp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Rrp9 APN 9 106485272 missense probably damaging 0.99
IGL02540:Rrp9 APN 9 106483547 unclassified probably benign
IGL02581:Rrp9 APN 9 106483628 missense probably damaging 1.00
P0005:Rrp9 UTSW 9 106481177 missense probably benign
R5585:Rrp9 UTSW 9 106485326 missense probably benign 0.35
R6135:Rrp9 UTSW 9 106483022 missense probably damaging 1.00
R6437:Rrp9 UTSW 9 106482951 missense probably benign 0.34
R6575:Rrp9 UTSW 9 106483579 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGACAAGTACAGATGCTCACAGC -3'
(R):5'- TAGGCAGGTGGTCAATACCCAGAG -3'

Sequencing Primer
(F):5'- CTGAGCCCACGTTCAGG -3'
(R):5'- GTCCCGTGAAGGTGTACAG -3'
Posted On2014-05-23