Mutagenetix > Incidental Mutations

Incidental Mutation 'R1757:Vnn1'

194980

Institutional Source

Beutler Lab

Gene Symbol

Vnn1

Ensembl Gene

ENSMUSG00000037440

Gene Name

vanin 1

Synonyms

V-1, pantetheinase

MMRRC Submission

039789-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R1757 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23894688-23905343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 23900829 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 359 (Q359H)

Ref Sequence

ENSEMBL: ENSMUSP00000040599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041416]

Predicted Effect

probably benign
Transcript: ENSMUST00000041416
AA Change: Q359H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: Q359H

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:CN_hydrolase	52	279	2.5e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219254

Meta Mutation Damage Score

0.1039

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

100% (111/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd6	A	T	14: 8,049,867	I219F	probably damaging	Het
Acvr1b	A	G	15: 101,198,822	I207V	possibly damaging	Het
Adamtsl4	T	C	3: 95,677,942	T839A	probably benign	Het
Akap1	C	T	11: 88,845,752	R61H	probably damaging	Het
Akap9	A	G	5: 4,001,667	D1478G	probably benign	Het
Aloxe3	T	A	11: 69,135,949	V547E	possibly damaging	Het
Ano6	G	A	15: 95,962,267	A757T	probably damaging	Het
Armc10	A	G	5: 21,653,457	T167A	probably damaging	Het
BB019430	A	C	10: 58,704,047		noncoding transcript	Het
Brms1	C	T	19: 5,046,407	R82W	probably damaging	Het
Btnl6	G	A	17: 34,514,088	T267I	probably benign	Het
Catsper4	A	T	4: 134,217,901	F215L	probably benign	Het
Ccdc105	T	C	10: 78,747,224	N442S	probably benign	Het
Ccdc188	T	C	16: 18,218,688	F197S	probably damaging	Het
Cers5	A	C	15: 99,736,331	C379G	probably benign	Het
Chchd6	A	G	6: 89,384,644	L259P	probably damaging	Het
Cntnap2	T	A	6: 46,759,829	C730S	probably damaging	Het
Coch	T	G	12: 51,602,848	V314G	probably damaging	Het
Cog1	T	A	11: 113,652,304	S213T	possibly damaging	Het
Crot	A	T	5: 8,987,828	F163I	probably damaging	Het
Cyp4f13	A	T	17: 32,929,958	I162N	probably damaging	Het
Dab2	A	T	15: 6,330,452		probably benign	Het
Depdc1b	C	T	13: 108,323,948	R31W	probably damaging	Het
Dlk1	T	C	12: 109,459,687	F161S	probably damaging	Het
Dnah6	T	C	6: 73,160,982	E913G	probably damaging	Het
Dnajc6	A	G	4: 101,597,831	Y5C	probably damaging	Het
Dock10	T	C	1: 80,533,869	T1508A	probably damaging	Het
Dstyk	A	G	1: 132,434,094		probably benign	Het
Efcc1	T	C	6: 87,749,283		probably benign	Het
Entpd1	T	C	19: 40,739,006	Y533H	probably benign	Het
Epha8	A	T	4: 136,931,478		probably null	Het
Erich3	C	T	3: 154,695,765	T17M	probably damaging	Het
Ethe1	T	C	7: 24,608,474		probably benign	Het
Fbxw15	A	T	9: 109,557,279	M211K	probably damaging	Het
Fhod3	G	A	18: 25,066,278	V669M	possibly damaging	Het
Fktn	C	T	4: 53,747,003		probably benign	Het
Foxred1	G	A	9: 35,210,834	R20C	probably benign	Het
Gbp9	A	G	5: 105,094,453	L140P	probably damaging	Het
Gga1	T	C	15: 78,889,030	L286P	probably damaging	Het
Gm11397	T	C	13: 33,399,353	S150P	probably benign	Het
Gml	T	C	15: 74,813,613		probably benign	Het
Gsap	A	T	5: 21,281,037	K628N	probably damaging	Het
Gtf3c4	G	A	2: 28,830,636		probably benign	Het
H2-M10.6	A	C	17: 36,813,151	Y169S	probably benign	Het
Hal	G	A	10: 93,494,628	V245I	probably benign	Het
Hebp2	T	C	10: 18,545,101	Y72C	probably damaging	Het
Helz2	T	C	2: 181,236,263	E914G	probably damaging	Het
Herc3	T	C	6: 58,916,470	Y906H	probably damaging	Het
Hfm1	A	T	5: 106,880,360		probably null	Het
Hgs	C	T	11: 120,480,063	P582S	probably damaging	Het
Hoxa10	G	A	6: 52,234,489	P149L	probably damaging	Het
Inpp5j	T	A	11: 3,504,738	Q4L	possibly damaging	Het
Ints8	A	C	4: 11,254,109	M1R	probably null	Het
Isg15	T	C	4: 156,199,990	E27G	possibly damaging	Het
Klf13	A	T	7: 63,891,765	C205S	probably damaging	Het
Lama1	G	A	17: 67,697,383	V17M	unknown	Het
Lama1	A	T	17: 67,763,836	Y830F	probably benign	Het
Lama3	A	G	18: 12,465,499	N988D	probably benign	Het
Lcat	CAT	C	8: 105,941,814		probably null	Het
Lct	G	T	1: 128,301,257	P833H	probably damaging	Het
Lmf1	A	T	17: 25,655,210	R403W	probably damaging	Het
Me3	T	G	7: 89,633,022	S38A	probably benign	Het
Myg1	A	T	15: 102,331,829	D30V	probably benign	Het
Nbea	A	G	3: 55,630,189	I2841T	possibly damaging	Het
Nek1	T	A	8: 61,089,813		probably null	Het
Obsl1	C	T	1: 75,493,883	R1043H	probably benign	Het
Olfr1158	T	G	2: 87,990,582	I157R	probably damaging	Het
Olfr1198	G	T	2: 88,746,017	D290E	probably benign	Het
Olfr1475	A	C	19: 13,479,607	V197G	possibly damaging	Het
Olfr430	A	T	1: 174,069,658	Y120F	probably damaging	Het
Osbpl9	A	G	4: 109,064,583	Y613H	probably damaging	Het
Per3	C	T	4: 151,042,792		probably null	Het
Pex6	G	T	17: 46,723,498	V758L	probably damaging	Het
Pikfyve	A	G	1: 65,252,548	I1309V	probably damaging	Het
Pimreg	A	G	11: 72,043,159	E37G	possibly damaging	Het
Pjvk	G	A	2: 76,655,888	V211I	probably benign	Het
Plekhg4	T	A	8: 105,381,661	V1112E	probably damaging	Het
Ptprz1	T	A	6: 23,044,320	M2106K	probably damaging	Het
Rdh16f2	G	T	10: 127,876,896	L254F	probably benign	Het
Rictor	G	A	15: 6,773,862	R485Q	possibly damaging	Het
Rnf146	G	A	10: 29,347,479	T137M	probably damaging	Het
Rrp9	T	A	9: 106,483,004	C204S	probably damaging	Het
Shkbp1	T	C	7: 27,342,351	T693A	probably benign	Het
Skint9	A	G	4: 112,413,962	Y84H	probably benign	Het
Slc22a12	A	T	19: 6,536,731		probably null	Het
Slfn4	T	C	11: 83,185,385	C26R	possibly damaging	Het
Snrnp200	T	C	2: 127,232,443	L1401P	probably damaging	Het
Specc1	T	A	11: 62,119,284		probably null	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Tbc1d22b	A	G	17: 29,571,673	R204G	probably damaging	Het
Tgfbr3l	C	A	8: 4,249,548	D110E	probably benign	Het
Ticrr	T	G	7: 79,675,323	S532R	probably damaging	Het
Ticrr	C	A	7: 79,679,046	Y644*	probably null	Het
Tmem5	T	C	10: 122,089,015	T261A	probably benign	Het
Traf3ip1	A	T	1: 91,522,857	T509S	probably damaging	Het
Trmt10b	T	C	4: 45,307,946	Y209H	probably damaging	Het
Trmt6	T	C	2: 132,810,237	M172V	probably damaging	Het
Tsc1	A	G	2: 28,686,113	D978G	probably benign	Het
Tshz2	C	A	2: 169,883,923	F146L	probably benign	Het
Tspyl4	G	T	10: 34,297,580	E23*	probably null	Het
Ulk2	A	T	11: 61,841,339		probably benign	Het
Umodl1	A	T	17: 31,008,700	I1336F	probably damaging	Het
Vezt	T	C	10: 93,970,563	D662G	probably benign	Het
Zdhhc16	A	G	19: 41,941,955	N14S	probably damaging	Het
Zfp455	T	C	13: 67,207,537	S225P	probably damaging	Het
Zfp74	T	A	7: 29,935,061	E407D	probably benign	Het
Zic2	T	A	14: 122,478,619	H384Q	possibly damaging	Het

Other mutations in Vnn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Vnn1	APN	10	23900779	missense	possibly damaging	0.51
IGL01299:Vnn1	APN	10	23895051	missense	probably damaging	1.00
IGL01353:Vnn1	APN	10	23900840	missense	probably damaging	1.00
IGL01774:Vnn1	APN	10	23900710	missense	probably benign	0.26
IGL01970:Vnn1	APN	10	23897402	missense	probably benign	0.06
IGL01985:Vnn1	APN	10	23900744	missense	probably benign	0.00
IGL02019:Vnn1	APN	10	23903551	missense	possibly damaging	0.69
IGL02198:Vnn1	APN	10	23903425	missense	probably benign	0.00
IGL02349:Vnn1	APN	10	23898503	missense	possibly damaging	0.91
IGL02738:Vnn1	APN	10	23904622	missense	probably benign	0.00
IGL03058:Vnn1	APN	10	23904544	missense	probably benign	0.06
R0008:Vnn1	UTSW	10	23898602	critical splice donor site	probably null
R0030:Vnn1	UTSW	10	23900846	missense	probably benign	0.08
R0508:Vnn1	UTSW	10	23895012	missense	probably benign	0.01
R0781:Vnn1	UTSW	10	23899601	missense	possibly damaging	0.46
R1110:Vnn1	UTSW	10	23899601	missense	possibly damaging	0.46
R1757:Vnn1	UTSW	10	23900828	missense	possibly damaging	0.49
R1778:Vnn1	UTSW	10	23899517	missense	possibly damaging	0.67
R2011:Vnn1	UTSW	10	23894971	nonsense	probably null
R2055:Vnn1	UTSW	10	23900577	splice site	probably benign
R2158:Vnn1	UTSW	10	23900755	nonsense	probably null
R2186:Vnn1	UTSW	10	23897401	missense	probably benign	0.29
R4277:Vnn1	UTSW	10	23898512	missense	possibly damaging	0.89
R4279:Vnn1	UTSW	10	23898512	missense	possibly damaging	0.89
R4473:Vnn1	UTSW	10	23894891	missense	probably benign
R4590:Vnn1	UTSW	10	23899405	missense	possibly damaging	0.61
R4708:Vnn1	UTSW	10	23897352	missense	probably benign	0.01
R4794:Vnn1	UTSW	10	23900704	missense	probably benign	0.01
R5266:Vnn1	UTSW	10	23903405	missense	probably damaging	1.00
R5495:Vnn1	UTSW	10	23898564	missense	probably damaging	0.98
R6064:Vnn1	UTSW	10	23894909	missense	probably benign	0.05
R7081:Vnn1	UTSW	10	23895005	missense	possibly damaging	0.66
R7088:Vnn1	UTSW	10	23900747	missense	probably benign	0.00
R7221:Vnn1	UTSW	10	23895054	missense	probably benign	0.07
R7334:Vnn1	UTSW	10	23900760	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGAAGTGGTATCTATGCACCCGATTCTC -3'
(R):5'- CAGTTTTGCTCGTCATTGGATCTTCTGG -3'

Sequencing Primer
(F):5'- AGGGTCTTTCACTACGACAGG -3'
(R):5'- GATCTTCTGGGGCTGACATTACC -3'

Posted On

2014-05-23