Incidental Mutation 'R0077:Fmnl1'
ID 19499
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission 038364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R0077 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103189969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 318 (F318S)
Ref Sequence ENSEMBL: ENSMUSP00000151439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect noncoding transcript
Transcript: ENSMUST00000021322
Predicted Effect probably damaging
Transcript: ENSMUST00000042286
AA Change: F312S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: F312S

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107027
AA Change: F312S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: F312S

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174079
Predicted Effect probably damaging
Transcript: ENSMUST00000218163
AA Change: F318S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9184 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.5%
Validation Efficiency 83% (159/192)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,771,685 probably benign Het
Adgrl4 A G 3: 151,517,781 I624V probably damaging Het
AI661453 A G 17: 47,469,362 probably benign Het
Alg12 C T 15: 88,815,978 E60K probably damaging Het
Angel2 A T 1: 190,933,087 N72Y possibly damaging Het
Ank1 C A 8: 23,140,167 P81Q probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Bpi T A 2: 158,261,334 M83K probably damaging Het
Capn7 A G 14: 31,368,115 I642V probably benign Het
Ccdc134 T C 15: 82,131,737 probably benign Het
Ccr3 C T 9: 124,029,024 T132I probably damaging Het
Cfap65 C A 1: 74,931,918 W80C probably damaging Het
Chaf1a T A 17: 56,047,384 I218K unknown Het
Ddx23 A G 15: 98,656,600 probably null Het
Dmkn A G 7: 30,765,294 S231G probably benign Het
Ep300 T C 15: 81,641,313 I1446T unknown Het
Grik5 A T 7: 25,023,380 V497E probably damaging Het
Gtf2ird2 T C 5: 134,214,083 Y380H probably damaging Het
Hecw2 C T 1: 53,868,831 probably benign Het
Hspb7 A G 4: 141,424,047 I167V probably damaging Het
Kcnh2 T A 5: 24,322,702 N884I probably benign Het
Krba1 T C 6: 48,405,225 probably benign Het
Krt18 G T 15: 102,030,974 R294L probably benign Het
Lctl T A 9: 64,122,107 M1K probably null Het
Lingo2 G A 4: 35,708,375 S535F possibly damaging Het
Lrba A C 3: 86,542,688 N2105H probably damaging Het
Lrrc10 A G 10: 117,045,514 D31G probably damaging Het
Lrrtm1 T A 6: 77,243,872 V104E probably damaging Het
Mgat3 C T 15: 80,212,577 T535I probably benign Het
Nav3 T C 10: 109,716,642 I1780V possibly damaging Het
Nlrc4 A G 17: 74,446,831 W186R probably damaging Het
Nr2c1 T A 10: 94,188,255 F441I probably benign Het
Obscn A G 11: 59,051,521 probably benign Het
Olfr221 T C 14: 52,035,985 N42S possibly damaging Het
Olfr444 T C 6: 42,955,773 S92P probably benign Het
Olfr59 T C 11: 74,288,675 F10L probably benign Het
Olfr688 T C 7: 105,288,519 V142A probably damaging Het
Osr1 A T 12: 9,579,691 Y188F probably damaging Het
Pak2 A T 16: 32,033,843 N293K possibly damaging Het
Pappa A T 4: 65,307,812 T1301S probably damaging Het
Pde4dip G A 3: 97,753,126 Q679* probably null Het
Pik3r5 T A 11: 68,486,622 probably null Het
Plbd2 C T 5: 120,486,039 probably null Het
Ppp1r3a G T 6: 14,754,517 P244T possibly damaging Het
Pum1 C A 4: 130,772,674 R960S probably benign Het
Ralgapb T C 2: 158,473,249 Y845H probably damaging Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Rdh1 A T 10: 127,760,037 I34F probably damaging Het
Rgl3 T A 9: 21,974,102 Q644L probably benign Het
Rpap2 T C 5: 107,620,474 S393P probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
S100a11 A C 3: 93,524,202 probably null Het
Sept4 T C 11: 87,581,196 S11P probably benign Het
Serpina1c T C 12: 103,896,091 S322G probably benign Het
Setdb1 A T 3: 95,341,451 C385S probably damaging Het
Shank2 A T 7: 144,192,467 I193F possibly damaging Het
Slc4a11 G T 2: 130,686,301 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tbcd C A 11: 121,594,274 Q761K probably benign Het
Tmed6 C T 8: 107,065,566 V16M probably damaging Het
Tmem229a T C 6: 24,955,702 T18A probably benign Het
Tsc1 T A 2: 28,678,943 probably benign Het
Ube2m T C 7: 13,035,730 N49D probably damaging Het
Ubqlnl T C 7: 104,150,047 D81G probably damaging Het
Vmn2r56 A G 7: 12,715,405 V302A probably benign Het
Vmn2r73 T A 7: 85,875,867 R24S probably benign Het
Wfs1 C A 5: 36,973,194 S236I probably damaging Het
Xpot A T 10: 121,605,639 N560K probably benign Het
Yipf3 A G 17: 46,251,577 T303A probably benign Het
Zfp790 T C 7: 29,824,875 W19R probably damaging Het
Zfp846 T C 9: 20,594,007 C388R probably benign Het
Zpr1 T A 9: 46,273,336 I47N probably damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103194033 missense unknown
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8946:Fmnl1 UTSW 11 103180915 missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103186618 small deletion probably benign
R9114:Fmnl1 UTSW 11 103196501 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACCCAAATGCTAGTGCAGCC -3'
(R):5'- TGTAACATCCAGATCCCCTTGGACC -3'

Sequencing Primer
(F):5'- TGCTAGTGCAGCCAGAGTAG -3'
(R):5'- ATCCCCTTGGACCAGTCCC -3'
Posted On 2013-04-11