Incidental Mutation 'R1758:Frem2'
ID 195057
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene Name Fras1 related extracellular matrix protein 2
Synonyms my, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 039790-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1758 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 53513938-53657355 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53653357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1243 (L1243P)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: L1243P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: L1243P

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,562,237 R38G possibly damaging Het
4930590J08Rik T C 6: 91,915,222 V155A possibly damaging Het
Adgb A G 10: 10,426,605 S406P probably damaging Het
Adgrb2 C A 4: 130,011,875 T893N probably damaging Het
Adgrf5 T C 17: 43,424,593 probably null Het
Alms1 T A 6: 85,628,505 I2379N probably damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf4 C T 15: 80,257,213 T268I probably benign Het
BC067074 A G 13: 113,368,732 T2132A possibly damaging Het
Ccdc154 T C 17: 25,163,182 L25P probably damaging Het
Ccdc9 G A 7: 16,276,236 S381F probably damaging Het
Cdk17 C T 10: 93,208,250 T17M probably damaging Het
Cep128 T C 12: 91,347,578 N142S probably benign Het
Cep78 A G 19: 15,959,536 I602T probably damaging Het
Clasp1 C T 1: 118,548,025 T935I probably damaging Het
Cnr1 T C 4: 33,945,000 S463P probably damaging Het
Cntnap1 T A 11: 101,184,623 W876R probably damaging Het
Cntnap5c A G 17: 58,042,550 D286G probably damaging Het
Copa C T 1: 172,104,144 R321C probably damaging Het
Ctla2a T G 13: 60,935,442 E98A probably damaging Het
Cux1 A T 5: 136,392,322 D183E probably damaging Het
Cxcl15 A C 5: 90,801,464 T163P unknown Het
Ddias T C 7: 92,859,363 N448S probably benign Het
Dhx8 T C 11: 101,766,738 F1152S probably damaging Het
Dnah12 C A 14: 26,766,114 Q992K probably benign Het
Eno3 G T 11: 70,661,425 W301L possibly damaging Het
Faap100 A T 11: 120,377,233 V238E probably damaging Het
Fgf4 A G 7: 144,862,312 S137G probably benign Het
Fhod3 A C 18: 25,120,310 D1439A possibly damaging Het
Gif G A 19: 11,757,815 M266I probably damaging Het
Gkn3 T G 6: 87,388,835 M1L probably benign Het
Gm10250 T C 15: 5,121,027 probably benign Het
Gm12185 T C 11: 48,908,032 T545A possibly damaging Het
Gm14226 T A 2: 155,025,458 L445H probably damaging Het
Gm3404 A T 5: 146,526,226 M73L probably benign Het
Gm4907 A G X: 23,906,751 I164V probably benign Het
Gm973 G T 1: 59,634,010 R976S unknown Het
Gpr146 A T 5: 139,393,382 H313L probably benign Het
Gys2 T A 6: 142,472,706 E32D probably damaging Het
Igsf10 G A 3: 59,329,196 T1188I probably benign Het
Igsf9b A T 9: 27,334,252 T1172S possibly damaging Het
Itga8 T A 2: 12,265,333 N114I possibly damaging Het
Itsn2 T A 12: 4,658,160 V795E possibly damaging Het
Kdm1b T A 13: 47,060,768 S197T probably benign Het
Kif5c G A 2: 49,723,133 R161Q probably benign Het
Krt33b T C 11: 100,025,535 Y232C probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1 A T 10: 127,588,584 N744K possibly damaging Het
Mcm10 C A 2: 5,004,050 L369F probably damaging Het
Muc5ac T A 7: 141,801,531 I1018N possibly damaging Het
Myom2 T C 8: 15,065,795 L70P probably benign Het
Myt1l T A 12: 29,827,242 N297K unknown Het
Ncr1 C T 7: 4,340,808 T98I probably benign Het
Nek3 T C 8: 22,160,262 E78G probably damaging Het
Nfatc3 T A 8: 106,099,136 N606K probably damaging Het
Nup107 T G 10: 117,761,343 D669A probably damaging Het
Olfr1113 A T 2: 87,213,414 Q174L probably benign Het
Olfr1264 T C 2: 90,021,329 T246A probably benign Het
Olfr922 A T 9: 38,815,575 H24L probably benign Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pcnx T C 12: 81,983,484 V1711A probably benign Het
Pik3c3 A G 18: 30,277,010 D99G probably damaging Het
Pinx1 C A 14: 63,919,575 T317K probably benign Het
Ppargc1b G T 18: 61,298,786 probably null Het
Pradc1 T A 6: 85,447,221 I119F possibly damaging Het
Psat1 G T 19: 15,914,879 T242K probably damaging Het
Psma6 G A 12: 55,407,532 C28Y probably damaging Het
Pyurf A T 6: 57,691,832 C58* probably null Het
Rab3gap2 C A 1: 185,283,884 A1331E probably benign Het
Rnase4 T C 14: 51,105,265 *149Q probably null Het
Ruvbl2 T C 7: 45,425,162 K184R probably benign Het
Scn7a T G 2: 66,680,183 M1292L probably benign Het
Scn7a A T 2: 66,700,887 Y549N probably damaging Het
Selp A G 1: 164,132,285 D370G possibly damaging Het
Slc22a15 G A 3: 101,860,453 Q386* probably null Het
Slc22a29 A G 19: 8,217,762 probably null Het
Slc26a7 A C 4: 14,548,491 I266S possibly damaging Het
Smpd4 T C 16: 17,626,008 S112P probably damaging Het
Smpd4 T A 16: 17,640,880 L165Q probably damaging Het
Snx33 A G 9: 56,926,698 I29T probably benign Het
Spen G A 4: 141,476,375 P1647L unknown Het
Strip2 T C 6: 29,941,941 probably null Het
Swsap1 C T 9: 21,955,984 R75* probably null Het
Tmem210 C T 2: 25,288,423 T32I probably damaging Het
Tnn C T 1: 160,147,584 R91H possibly damaging Het
Tnni1 G A 1: 135,808,682 R94H probably damaging Het
Tnrc6c T A 11: 117,760,730 V1693D probably benign Het
Trip4 G A 9: 65,874,977 Q158* probably null Het
Ttc39b T C 4: 83,237,349 E474G probably damaging Het
Usp50 C A 2: 126,775,862 C221F probably damaging Het
Vmn1r171 T C 7: 23,632,356 I2T probably benign Het
Wdr62 T A 7: 30,267,903 I309F probably damaging Het
Xdh A T 17: 73,910,209 V688E probably damaging Het
Zfyve26 A G 12: 79,238,944 L2353P probably damaging Het
Zgpat C A 2: 181,378,840 R269S probably damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7455:Frem2 UTSW 3 53572280 splice site probably null
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
R7636:Frem2 UTSW 3 53653247 missense probably benign 0.00
R7703:Frem2 UTSW 3 53522168 missense probably benign 0.01
R7750:Frem2 UTSW 3 53523682 missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R7922:Frem2 UTSW 3 53653304 missense probably damaging 0.98
R8008:Frem2 UTSW 3 53652910 missense probably damaging 1.00
R8051:Frem2 UTSW 3 53535355 missense probably benign 0.04
R8052:Frem2 UTSW 3 53549643 missense probably benign 0.02
R8176:Frem2 UTSW 3 53655340 missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53656507 nonsense probably null
R8397:Frem2 UTSW 3 53653141 missense probably benign 0.00
R8410:Frem2 UTSW 3 53539177 missense possibly damaging 0.60
R8697:Frem2 UTSW 3 53525828 missense probably damaging 0.99
R9134:Frem2 UTSW 3 53654900 missense probably damaging 1.00
R9183:Frem2 UTSW 3 53520065 missense probably damaging 1.00
R9260:Frem2 UTSW 3 53652783 missense probably damaging 1.00
R9267:Frem2 UTSW 3 53657083 start codon destroyed probably null 0.00
R9299:Frem2 UTSW 3 53656559 missense probably benign 0.37
R9378:Frem2 UTSW 3 53651989 missense probably damaging 0.99
R9444:Frem2 UTSW 3 53652844 missense probably benign 0.10
R9459:Frem2 UTSW 3 53653486 missense probably benign
R9487:Frem2 UTSW 3 53653484 missense possibly damaging 0.95
Z1177:Frem2 UTSW 3 53535166 missense probably null 1.00
Z1177:Frem2 UTSW 3 53655607 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGTCTCTGTAACAAGCCATGCCC -3'
(R):5'- TTCCTACCAATGACGAGCAGCCAG -3'

Sequencing Primer
(F):5'- CTAGATCGGTTGCCATTAGGAC -3'
(R):5'- CAATGACGAGCAGCCAGAAATG -3'
Posted On 2014-05-23