Incidental Mutation 'R1758:Cnr1'
ID195061
Institutional Source Beutler Lab
Gene Symbol Cnr1
Ensembl Gene ENSMUSG00000044288
Gene Namecannabinoid receptor 1 (brain)
SynonymsCB1R, CB1
MMRRC Submission 039790-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R1758 (G1)
Quality Score214
Status Not validated
Chromosome4
Chromosomal Location33924593-33948831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33945000 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 463 (S463P)
Ref Sequence ENSEMBL: ENSMUSP00000081787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057188] [ENSMUST00000084736]
Predicted Effect probably damaging
Transcript: ENSMUST00000057188
AA Change: S463P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055797
Gene: ENSMUSG00000044288
AA Change: S463P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 125 319 1.4e-7 PFAM
Pfam:7TM_GPCR_Srv 126 415 1.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 127 413 1.4e-14 PFAM
Pfam:7tm_1 134 398 2.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084736
AA Change: S463P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081787
Gene: ENSMUSG00000044288
AA Change: S463P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 125 319 1.9e-7 PFAM
Pfam:7TM_GPCR_Srv 126 415 1.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 127 413 1.4e-14 PFAM
Pfam:7tm_1 134 398 2.2e-52 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors, altered long term depression and susceptibility to induced seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,562,237 R38G possibly damaging Het
4930590J08Rik T C 6: 91,915,222 V155A possibly damaging Het
Adgb A G 10: 10,426,605 S406P probably damaging Het
Adgrb2 C A 4: 130,011,875 T893N probably damaging Het
Adgrf5 T C 17: 43,424,593 probably null Het
Alms1 T A 6: 85,628,505 I2379N probably damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf4 C T 15: 80,257,213 T268I probably benign Het
BC067074 A G 13: 113,368,732 T2132A possibly damaging Het
Ccdc154 T C 17: 25,163,182 L25P probably damaging Het
Ccdc9 G A 7: 16,276,236 S381F probably damaging Het
Cdk17 C T 10: 93,208,250 T17M probably damaging Het
Cep128 T C 12: 91,347,578 N142S probably benign Het
Cep78 A G 19: 15,959,536 I602T probably damaging Het
Clasp1 C T 1: 118,548,025 T935I probably damaging Het
Cntnap1 T A 11: 101,184,623 W876R probably damaging Het
Cntnap5c A G 17: 58,042,550 D286G probably damaging Het
Copa C T 1: 172,104,144 R321C probably damaging Het
Ctla2a T G 13: 60,935,442 E98A probably damaging Het
Cux1 A T 5: 136,392,322 D183E probably damaging Het
Cxcl15 A C 5: 90,801,464 T163P unknown Het
Ddias T C 7: 92,859,363 N448S probably benign Het
Dhx8 T C 11: 101,766,738 F1152S probably damaging Het
Dnah12 C A 14: 26,766,114 Q992K probably benign Het
Eno3 G T 11: 70,661,425 W301L possibly damaging Het
Faap100 A T 11: 120,377,233 V238E probably damaging Het
Fgf4 A G 7: 144,862,312 S137G probably benign Het
Fhod3 A C 18: 25,120,310 D1439A possibly damaging Het
Frem2 A G 3: 53,653,357 L1243P probably damaging Het
Gif G A 19: 11,757,815 M266I probably damaging Het
Gkn3 T G 6: 87,388,835 M1L probably benign Het
Gm10250 T C 15: 5,121,027 probably benign Het
Gm12185 T C 11: 48,908,032 T545A possibly damaging Het
Gm14226 T A 2: 155,025,458 L445H probably damaging Het
Gm3404 A T 5: 146,526,226 M73L probably benign Het
Gm4907 A G X: 23,906,751 I164V probably benign Het
Gm973 G T 1: 59,634,010 R976S unknown Het
Gpr146 A T 5: 139,393,382 H313L probably benign Het
Gys2 T A 6: 142,472,706 E32D probably damaging Het
Igsf10 G A 3: 59,329,196 T1188I probably benign Het
Igsf9b A T 9: 27,334,252 T1172S possibly damaging Het
Itga8 T A 2: 12,265,333 N114I possibly damaging Het
Itsn2 T A 12: 4,658,160 V795E possibly damaging Het
Kdm1b T A 13: 47,060,768 S197T probably benign Het
Kif5c G A 2: 49,723,133 R161Q probably benign Het
Krt33b T C 11: 100,025,535 Y232C probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1 A T 10: 127,588,584 N744K possibly damaging Het
Mcm10 C A 2: 5,004,050 L369F probably damaging Het
Muc5ac T A 7: 141,801,531 I1018N possibly damaging Het
Myom2 T C 8: 15,065,795 L70P probably benign Het
Myt1l T A 12: 29,827,242 N297K unknown Het
Ncr1 C T 7: 4,340,808 T98I probably benign Het
Nek3 T C 8: 22,160,262 E78G probably damaging Het
Nfatc3 T A 8: 106,099,136 N606K probably damaging Het
Nup107 T G 10: 117,761,343 D669A probably damaging Het
Olfr1113 A T 2: 87,213,414 Q174L probably benign Het
Olfr1264 T C 2: 90,021,329 T246A probably benign Het
Olfr922 A T 9: 38,815,575 H24L probably benign Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pcnx T C 12: 81,983,484 V1711A probably benign Het
Pik3c3 A G 18: 30,277,010 D99G probably damaging Het
Pinx1 C A 14: 63,919,575 T317K probably benign Het
Ppargc1b G T 18: 61,298,786 probably null Het
Pradc1 T A 6: 85,447,221 I119F possibly damaging Het
Psat1 G T 19: 15,914,879 T242K probably damaging Het
Psma6 G A 12: 55,407,532 C28Y probably damaging Het
Pyurf A T 6: 57,691,832 C58* probably null Het
Rab3gap2 C A 1: 185,283,884 A1331E probably benign Het
Rnase4 T C 14: 51,105,265 *149Q probably null Het
Ruvbl2 T C 7: 45,425,162 K184R probably benign Het
Scn7a T G 2: 66,680,183 M1292L probably benign Het
Scn7a A T 2: 66,700,887 Y549N probably damaging Het
Selp A G 1: 164,132,285 D370G possibly damaging Het
Slc22a15 G A 3: 101,860,453 Q386* probably null Het
Slc22a29 A G 19: 8,217,762 probably null Het
Slc26a7 A C 4: 14,548,491 I266S possibly damaging Het
Smpd4 T C 16: 17,626,008 S112P probably damaging Het
Smpd4 T A 16: 17,640,880 L165Q probably damaging Het
Snx33 A G 9: 56,926,698 I29T probably benign Het
Spen G A 4: 141,476,375 P1647L unknown Het
Strip2 T C 6: 29,941,941 probably null Het
Swsap1 C T 9: 21,955,984 R75* probably null Het
Tmem210 C T 2: 25,288,423 T32I probably damaging Het
Tnn C T 1: 160,147,584 R91H possibly damaging Het
Tnni1 G A 1: 135,808,682 R94H probably damaging Het
Tnrc6c T A 11: 117,760,730 V1693D probably benign Het
Trip4 G A 9: 65,874,977 Q158* probably null Het
Ttc39b T C 4: 83,237,349 E474G probably damaging Het
Usp50 C A 2: 126,775,862 C221F probably damaging Het
Vmn1r171 T C 7: 23,632,356 I2T probably benign Het
Wdr62 T A 7: 30,267,903 I309F probably damaging Het
Xdh A T 17: 73,910,209 V688E probably damaging Het
Zfyve26 A G 12: 79,238,944 L2353P probably damaging Het
Zgpat C A 2: 181,378,840 R269S probably damaging Het
Other mutations in Cnr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cnr1 APN 4 33944116 missense probably damaging 1.00
IGL01408:Cnr1 APN 4 33944802 missense possibly damaging 0.88
IGL02551:Cnr1 APN 4 33943686 missense probably benign
Madness UTSW 4 33944330 nonsense probably null
R1730:Cnr1 UTSW 4 33943851 missense possibly damaging 0.52
R2322:Cnr1 UTSW 4 33944514 missense probably damaging 1.00
R4688:Cnr1 UTSW 4 33944571 missense probably benign 0.38
R5289:Cnr1 UTSW 4 33943910 nonsense probably null
R5707:Cnr1 UTSW 4 33944330 nonsense probably null
R6042:Cnr1 UTSW 4 33944751 missense probably damaging 1.00
R6630:Cnr1 UTSW 4 33944659 missense probably damaging 1.00
R6724:Cnr1 UTSW 4 33944728 missense possibly damaging 0.70
R6916:Cnr1 UTSW 4 33943897 missense probably benign
R6987:Cnr1 UTSW 4 33944739 missense probably benign 0.00
R7410:Cnr1 UTSW 4 33944119 missense probably damaging 1.00
R7721:Cnr1 UTSW 4 33944416 missense probably damaging 1.00
R7723:Cnr1 UTSW 4 33944416 missense probably damaging 1.00
U24488:Cnr1 UTSW 4 33944927 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGGACCTGAGACATGCTTTCCG -3'
(R):5'- TTGAAGGATCGCCGAGCAACTG -3'

Sequencing Primer
(F):5'- AGATAACAGCATGGGGGACT -3'
(R):5'- TTTTCTGGGCAGCCACAA -3'
Posted On2014-05-23