Incidental Mutation 'R1758:Alms1'
ID195073
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene NameALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 039790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1758 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85587531-85702753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85628505 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2379 (I2379N)
Ref Sequence ENSEMBL: ENSMUSP00000148796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
Predicted Effect probably damaging
Transcript: ENSMUST00000072018
AA Change: I1910N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: I1910N

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201862
Predicted Effect probably damaging
Transcript: ENSMUST00000213058
AA Change: I2379N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,562,237 R38G possibly damaging Het
4930590J08Rik T C 6: 91,915,222 V155A possibly damaging Het
Adgb A G 10: 10,426,605 S406P probably damaging Het
Adgrb2 C A 4: 130,011,875 T893N probably damaging Het
Adgrf5 T C 17: 43,424,593 probably null Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf4 C T 15: 80,257,213 T268I probably benign Het
BC067074 A G 13: 113,368,732 T2132A possibly damaging Het
Ccdc154 T C 17: 25,163,182 L25P probably damaging Het
Ccdc9 G A 7: 16,276,236 S381F probably damaging Het
Cdk17 C T 10: 93,208,250 T17M probably damaging Het
Cep128 T C 12: 91,347,578 N142S probably benign Het
Cep78 A G 19: 15,959,536 I602T probably damaging Het
Clasp1 C T 1: 118,548,025 T935I probably damaging Het
Cnr1 T C 4: 33,945,000 S463P probably damaging Het
Cntnap1 T A 11: 101,184,623 W876R probably damaging Het
Cntnap5c A G 17: 58,042,550 D286G probably damaging Het
Copa C T 1: 172,104,144 R321C probably damaging Het
Ctla2a T G 13: 60,935,442 E98A probably damaging Het
Cux1 A T 5: 136,392,322 D183E probably damaging Het
Cxcl15 A C 5: 90,801,464 T163P unknown Het
Ddias T C 7: 92,859,363 N448S probably benign Het
Dhx8 T C 11: 101,766,738 F1152S probably damaging Het
Dnah12 C A 14: 26,766,114 Q992K probably benign Het
Eno3 G T 11: 70,661,425 W301L possibly damaging Het
Faap100 A T 11: 120,377,233 V238E probably damaging Het
Fgf4 A G 7: 144,862,312 S137G probably benign Het
Fhod3 A C 18: 25,120,310 D1439A possibly damaging Het
Frem2 A G 3: 53,653,357 L1243P probably damaging Het
Gif G A 19: 11,757,815 M266I probably damaging Het
Gkn3 T G 6: 87,388,835 M1L probably benign Het
Gm10250 T C 15: 5,121,027 probably benign Het
Gm12185 T C 11: 48,908,032 T545A possibly damaging Het
Gm14226 T A 2: 155,025,458 L445H probably damaging Het
Gm3404 A T 5: 146,526,226 M73L probably benign Het
Gm4907 A G X: 23,906,751 I164V probably benign Het
Gm973 G T 1: 59,634,010 R976S unknown Het
Gpr146 A T 5: 139,393,382 H313L probably benign Het
Gys2 T A 6: 142,472,706 E32D probably damaging Het
Igsf10 G A 3: 59,329,196 T1188I probably benign Het
Igsf9b A T 9: 27,334,252 T1172S possibly damaging Het
Itga8 T A 2: 12,265,333 N114I possibly damaging Het
Itsn2 T A 12: 4,658,160 V795E possibly damaging Het
Kdm1b T A 13: 47,060,768 S197T probably benign Het
Kif5c G A 2: 49,723,133 R161Q probably benign Het
Krt33b T C 11: 100,025,535 Y232C probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1 A T 10: 127,588,584 N744K possibly damaging Het
Mcm10 C A 2: 5,004,050 L369F probably damaging Het
Muc5ac T A 7: 141,801,531 I1018N possibly damaging Het
Myom2 T C 8: 15,065,795 L70P probably benign Het
Myt1l T A 12: 29,827,242 N297K unknown Het
Ncr1 C T 7: 4,340,808 T98I probably benign Het
Nek3 T C 8: 22,160,262 E78G probably damaging Het
Nfatc3 T A 8: 106,099,136 N606K probably damaging Het
Nup107 T G 10: 117,761,343 D669A probably damaging Het
Olfr1113 A T 2: 87,213,414 Q174L probably benign Het
Olfr1264 T C 2: 90,021,329 T246A probably benign Het
Olfr922 A T 9: 38,815,575 H24L probably benign Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pcnx T C 12: 81,983,484 V1711A probably benign Het
Pik3c3 A G 18: 30,277,010 D99G probably damaging Het
Pinx1 C A 14: 63,919,575 T317K probably benign Het
Ppargc1b G T 18: 61,298,786 probably null Het
Pradc1 T A 6: 85,447,221 I119F possibly damaging Het
Psat1 G T 19: 15,914,879 T242K probably damaging Het
Psma6 G A 12: 55,407,532 C28Y probably damaging Het
Pyurf A T 6: 57,691,832 C58* probably null Het
Rab3gap2 C A 1: 185,283,884 A1331E probably benign Het
Rnase4 T C 14: 51,105,265 *149Q probably null Het
Ruvbl2 T C 7: 45,425,162 K184R probably benign Het
Scn7a T G 2: 66,680,183 M1292L probably benign Het
Scn7a A T 2: 66,700,887 Y549N probably damaging Het
Selp A G 1: 164,132,285 D370G possibly damaging Het
Slc22a15 G A 3: 101,860,453 Q386* probably null Het
Slc22a29 A G 19: 8,217,762 probably null Het
Slc26a7 A C 4: 14,548,491 I266S possibly damaging Het
Smpd4 T C 16: 17,626,008 S112P probably damaging Het
Smpd4 T A 16: 17,640,880 L165Q probably damaging Het
Snx33 A G 9: 56,926,698 I29T probably benign Het
Spen G A 4: 141,476,375 P1647L unknown Het
Strip2 T C 6: 29,941,941 probably null Het
Swsap1 C T 9: 21,955,984 R75* probably null Het
Tmem210 C T 2: 25,288,423 T32I probably damaging Het
Tnn C T 1: 160,147,584 R91H possibly damaging Het
Tnni1 G A 1: 135,808,682 R94H probably damaging Het
Tnrc6c T A 11: 117,760,730 V1693D probably benign Het
Trip4 G A 9: 65,874,977 Q158* probably null Het
Ttc39b T C 4: 83,237,349 E474G probably damaging Het
Usp50 C A 2: 126,775,862 C221F probably damaging Het
Vmn1r171 T C 7: 23,632,356 I2T probably benign Het
Wdr62 T A 7: 30,267,903 I309F probably damaging Het
Xdh A T 17: 73,910,209 V688E probably damaging Het
Zfyve26 A G 12: 79,238,944 L2353P probably damaging Het
Zgpat C A 2: 181,378,840 R269S probably damaging Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85620412 missense probably damaging 1.00
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
R7849:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R7932:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R8048:Alms1 UTSW 6 85641334 missense probably benign 0.13
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85678418 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATCGGAGCCCATCATCATGGAGAG -3'
(R):5'- AGTTTGTCCTGGCTAACAATGGTATCC -3'

Sequencing Primer
(F):5'- AGAACCTACTTGTGTGCCAG -3'
(R):5'- GGCTAACAATGGTATCCTTACCAG -3'
Posted On2014-05-23