Incidental Mutation 'R1758:Pcnx'
ID195116
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission 039790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1758 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81983484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1711 (V1711A)
Ref Sequence ENSEMBL: ENSMUSP00000021567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably benign
Transcript: ENSMUST00000021567
AA Change: V1711A

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: V1711A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000221675
AA Change: V1072A
Predicted Effect probably benign
Transcript: ENSMUST00000221721
AA Change: V1705A

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000222005
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,562,237 R38G possibly damaging Het
4930590J08Rik T C 6: 91,915,222 V155A possibly damaging Het
Adgb A G 10: 10,426,605 S406P probably damaging Het
Adgrb2 C A 4: 130,011,875 T893N probably damaging Het
Adgrf5 T C 17: 43,424,593 probably null Het
Alms1 T A 6: 85,628,505 I2379N probably damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf4 C T 15: 80,257,213 T268I probably benign Het
BC067074 A G 13: 113,368,732 T2132A possibly damaging Het
Ccdc154 T C 17: 25,163,182 L25P probably damaging Het
Ccdc9 G A 7: 16,276,236 S381F probably damaging Het
Cdk17 C T 10: 93,208,250 T17M probably damaging Het
Cep128 T C 12: 91,347,578 N142S probably benign Het
Cep78 A G 19: 15,959,536 I602T probably damaging Het
Clasp1 C T 1: 118,548,025 T935I probably damaging Het
Cnr1 T C 4: 33,945,000 S463P probably damaging Het
Cntnap1 T A 11: 101,184,623 W876R probably damaging Het
Cntnap5c A G 17: 58,042,550 D286G probably damaging Het
Copa C T 1: 172,104,144 R321C probably damaging Het
Ctla2a T G 13: 60,935,442 E98A probably damaging Het
Cux1 A T 5: 136,392,322 D183E probably damaging Het
Cxcl15 A C 5: 90,801,464 T163P unknown Het
Ddias T C 7: 92,859,363 N448S probably benign Het
Dhx8 T C 11: 101,766,738 F1152S probably damaging Het
Dnah12 C A 14: 26,766,114 Q992K probably benign Het
Eno3 G T 11: 70,661,425 W301L possibly damaging Het
Faap100 A T 11: 120,377,233 V238E probably damaging Het
Fgf4 A G 7: 144,862,312 S137G probably benign Het
Fhod3 A C 18: 25,120,310 D1439A possibly damaging Het
Frem2 A G 3: 53,653,357 L1243P probably damaging Het
Gif G A 19: 11,757,815 M266I probably damaging Het
Gkn3 T G 6: 87,388,835 M1L probably benign Het
Gm10250 T C 15: 5,121,027 probably benign Het
Gm12185 T C 11: 48,908,032 T545A possibly damaging Het
Gm14226 T A 2: 155,025,458 L445H probably damaging Het
Gm3404 A T 5: 146,526,226 M73L probably benign Het
Gm4907 A G X: 23,906,751 I164V probably benign Het
Gm973 G T 1: 59,634,010 R976S unknown Het
Gpr146 A T 5: 139,393,382 H313L probably benign Het
Gys2 T A 6: 142,472,706 E32D probably damaging Het
Igsf10 G A 3: 59,329,196 T1188I probably benign Het
Igsf9b A T 9: 27,334,252 T1172S possibly damaging Het
Itga8 T A 2: 12,265,333 N114I possibly damaging Het
Itsn2 T A 12: 4,658,160 V795E possibly damaging Het
Kdm1b T A 13: 47,060,768 S197T probably benign Het
Kif5c G A 2: 49,723,133 R161Q probably benign Het
Krt33b T C 11: 100,025,535 Y232C probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1 A T 10: 127,588,584 N744K possibly damaging Het
Mcm10 C A 2: 5,004,050 L369F probably damaging Het
Muc5ac T A 7: 141,801,531 I1018N possibly damaging Het
Myom2 T C 8: 15,065,795 L70P probably benign Het
Myt1l T A 12: 29,827,242 N297K unknown Het
Ncr1 C T 7: 4,340,808 T98I probably benign Het
Nek3 T C 8: 22,160,262 E78G probably damaging Het
Nfatc3 T A 8: 106,099,136 N606K probably damaging Het
Nup107 T G 10: 117,761,343 D669A probably damaging Het
Olfr1113 A T 2: 87,213,414 Q174L probably benign Het
Olfr1264 T C 2: 90,021,329 T246A probably benign Het
Olfr922 A T 9: 38,815,575 H24L probably benign Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pik3c3 A G 18: 30,277,010 D99G probably damaging Het
Pinx1 C A 14: 63,919,575 T317K probably benign Het
Ppargc1b G T 18: 61,298,786 probably null Het
Pradc1 T A 6: 85,447,221 I119F possibly damaging Het
Psat1 G T 19: 15,914,879 T242K probably damaging Het
Psma6 G A 12: 55,407,532 C28Y probably damaging Het
Pyurf A T 6: 57,691,832 C58* probably null Het
Rab3gap2 C A 1: 185,283,884 A1331E probably benign Het
Rnase4 T C 14: 51,105,265 *149Q probably null Het
Ruvbl2 T C 7: 45,425,162 K184R probably benign Het
Scn7a T G 2: 66,680,183 M1292L probably benign Het
Scn7a A T 2: 66,700,887 Y549N probably damaging Het
Selp A G 1: 164,132,285 D370G possibly damaging Het
Slc22a15 G A 3: 101,860,453 Q386* probably null Het
Slc22a29 A G 19: 8,217,762 probably null Het
Slc26a7 A C 4: 14,548,491 I266S possibly damaging Het
Smpd4 T C 16: 17,626,008 S112P probably damaging Het
Smpd4 T A 16: 17,640,880 L165Q probably damaging Het
Snx33 A G 9: 56,926,698 I29T probably benign Het
Spen G A 4: 141,476,375 P1647L unknown Het
Strip2 T C 6: 29,941,941 probably null Het
Swsap1 C T 9: 21,955,984 R75* probably null Het
Tmem210 C T 2: 25,288,423 T32I probably damaging Het
Tnn C T 1: 160,147,584 R91H possibly damaging Het
Tnni1 G A 1: 135,808,682 R94H probably damaging Het
Tnrc6c T A 11: 117,760,730 V1693D probably benign Het
Trip4 G A 9: 65,874,977 Q158* probably null Het
Ttc39b T C 4: 83,237,349 E474G probably damaging Het
Usp50 C A 2: 126,775,862 C221F probably damaging Het
Vmn1r171 T C 7: 23,632,356 I2T probably benign Het
Wdr62 T A 7: 30,267,903 I309F probably damaging Het
Xdh A T 17: 73,910,209 V688E probably damaging Het
Zfyve26 A G 12: 79,238,944 L2353P probably damaging Het
Zgpat C A 2: 181,378,840 R269S probably damaging Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
R8078:Pcnx UTSW 12 81975280 missense
R8093:Pcnx UTSW 12 81918819 nonsense probably null
R8104:Pcnx UTSW 12 81983611 nonsense probably null
R8108:Pcnx UTSW 12 81918819 nonsense probably null
R8131:Pcnx UTSW 12 81918518 missense possibly damaging 0.80
R8136:Pcnx UTSW 12 81918006 missense probably benign
R8153:Pcnx UTSW 12 81918819 nonsense probably null
R8156:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- CACTGCAAGTTGCCTTGCTGAAC -3'
(R):5'- ACAGAAGCTCTCCCGAGATATGCC -3'

Sequencing Primer
(F):5'- GCTTTCTTAAAATGTAGGCGTAGGAC -3'
(R):5'- GAGATATGCCTGCCAGCC -3'
Posted On2014-05-23