Incidental Mutation 'R1758:Olfr95'
ID195131
Institutional Source Beutler Lab
Gene Symbol Olfr95
Ensembl Gene ENSMUSG00000049561
Gene Nameolfactory receptor 95
SynonymsMOR263-6, GA_x6K02T2PSCP-1651760-1650822
MMRRC Submission 039790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1758 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37207950-37213118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37211313 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 180 (I180N)
Ref Sequence ENSEMBL: ENSMUSP00000150480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060728] [ENSMUST00000216318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060728
AA Change: I180N

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058929
Gene: ENSMUSG00000049561
AA Change: I180N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.9e-57 PFAM
Pfam:7TM_GPCR_Srsx 34 259 1.7e-6 PFAM
Pfam:7tm_1 40 289 2.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216318
AA Change: I180N

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,562,237 R38G possibly damaging Het
4930590J08Rik T C 6: 91,915,222 V155A possibly damaging Het
Adgb A G 10: 10,426,605 S406P probably damaging Het
Adgrb2 C A 4: 130,011,875 T893N probably damaging Het
Adgrf5 T C 17: 43,424,593 probably null Het
Alms1 T A 6: 85,628,505 I2379N probably damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf4 C T 15: 80,257,213 T268I probably benign Het
BC067074 A G 13: 113,368,732 T2132A possibly damaging Het
Ccdc154 T C 17: 25,163,182 L25P probably damaging Het
Ccdc9 G A 7: 16,276,236 S381F probably damaging Het
Cdk17 C T 10: 93,208,250 T17M probably damaging Het
Cep128 T C 12: 91,347,578 N142S probably benign Het
Cep78 A G 19: 15,959,536 I602T probably damaging Het
Clasp1 C T 1: 118,548,025 T935I probably damaging Het
Cnr1 T C 4: 33,945,000 S463P probably damaging Het
Cntnap1 T A 11: 101,184,623 W876R probably damaging Het
Cntnap5c A G 17: 58,042,550 D286G probably damaging Het
Copa C T 1: 172,104,144 R321C probably damaging Het
Ctla2a T G 13: 60,935,442 E98A probably damaging Het
Cux1 A T 5: 136,392,322 D183E probably damaging Het
Cxcl15 A C 5: 90,801,464 T163P unknown Het
Ddias T C 7: 92,859,363 N448S probably benign Het
Dhx8 T C 11: 101,766,738 F1152S probably damaging Het
Dnah12 C A 14: 26,766,114 Q992K probably benign Het
Eno3 G T 11: 70,661,425 W301L possibly damaging Het
Faap100 A T 11: 120,377,233 V238E probably damaging Het
Fgf4 A G 7: 144,862,312 S137G probably benign Het
Fhod3 A C 18: 25,120,310 D1439A possibly damaging Het
Frem2 A G 3: 53,653,357 L1243P probably damaging Het
Gif G A 19: 11,757,815 M266I probably damaging Het
Gkn3 T G 6: 87,388,835 M1L probably benign Het
Gm10250 T C 15: 5,121,027 probably benign Het
Gm12185 T C 11: 48,908,032 T545A possibly damaging Het
Gm14226 T A 2: 155,025,458 L445H probably damaging Het
Gm3404 A T 5: 146,526,226 M73L probably benign Het
Gm4907 A G X: 23,906,751 I164V probably benign Het
Gm973 G T 1: 59,634,010 R976S unknown Het
Gpr146 A T 5: 139,393,382 H313L probably benign Het
Gys2 T A 6: 142,472,706 E32D probably damaging Het
Igsf10 G A 3: 59,329,196 T1188I probably benign Het
Igsf9b A T 9: 27,334,252 T1172S possibly damaging Het
Itga8 T A 2: 12,265,333 N114I possibly damaging Het
Itsn2 T A 12: 4,658,160 V795E possibly damaging Het
Kdm1b T A 13: 47,060,768 S197T probably benign Het
Kif5c G A 2: 49,723,133 R161Q probably benign Het
Krt33b T C 11: 100,025,535 Y232C probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1 A T 10: 127,588,584 N744K possibly damaging Het
Mcm10 C A 2: 5,004,050 L369F probably damaging Het
Muc5ac T A 7: 141,801,531 I1018N possibly damaging Het
Myom2 T C 8: 15,065,795 L70P probably benign Het
Myt1l T A 12: 29,827,242 N297K unknown Het
Ncr1 C T 7: 4,340,808 T98I probably benign Het
Nek3 T C 8: 22,160,262 E78G probably damaging Het
Nfatc3 T A 8: 106,099,136 N606K probably damaging Het
Nup107 T G 10: 117,761,343 D669A probably damaging Het
Olfr1113 A T 2: 87,213,414 Q174L probably benign Het
Olfr1264 T C 2: 90,021,329 T246A probably benign Het
Olfr922 A T 9: 38,815,575 H24L probably benign Het
Pcnx T C 12: 81,983,484 V1711A probably benign Het
Pik3c3 A G 18: 30,277,010 D99G probably damaging Het
Pinx1 C A 14: 63,919,575 T317K probably benign Het
Ppargc1b G T 18: 61,298,786 probably null Het
Pradc1 T A 6: 85,447,221 I119F possibly damaging Het
Psat1 G T 19: 15,914,879 T242K probably damaging Het
Psma6 G A 12: 55,407,532 C28Y probably damaging Het
Pyurf A T 6: 57,691,832 C58* probably null Het
Rab3gap2 C A 1: 185,283,884 A1331E probably benign Het
Rnase4 T C 14: 51,105,265 *149Q probably null Het
Ruvbl2 T C 7: 45,425,162 K184R probably benign Het
Scn7a T G 2: 66,680,183 M1292L probably benign Het
Scn7a A T 2: 66,700,887 Y549N probably damaging Het
Selp A G 1: 164,132,285 D370G possibly damaging Het
Slc22a15 G A 3: 101,860,453 Q386* probably null Het
Slc22a29 A G 19: 8,217,762 probably null Het
Slc26a7 A C 4: 14,548,491 I266S possibly damaging Het
Smpd4 T C 16: 17,626,008 S112P probably damaging Het
Smpd4 T A 16: 17,640,880 L165Q probably damaging Het
Snx33 A G 9: 56,926,698 I29T probably benign Het
Spen G A 4: 141,476,375 P1647L unknown Het
Strip2 T C 6: 29,941,941 probably null Het
Swsap1 C T 9: 21,955,984 R75* probably null Het
Tmem210 C T 2: 25,288,423 T32I probably damaging Het
Tnn C T 1: 160,147,584 R91H possibly damaging Het
Tnni1 G A 1: 135,808,682 R94H probably damaging Het
Tnrc6c T A 11: 117,760,730 V1693D probably benign Het
Trip4 G A 9: 65,874,977 Q158* probably null Het
Ttc39b T C 4: 83,237,349 E474G probably damaging Het
Usp50 C A 2: 126,775,862 C221F probably damaging Het
Vmn1r171 T C 7: 23,632,356 I2T probably benign Het
Wdr62 T A 7: 30,267,903 I309F probably damaging Het
Xdh A T 17: 73,910,209 V688E probably damaging Het
Zfyve26 A G 12: 79,238,944 L2353P probably damaging Het
Zgpat C A 2: 181,378,840 R269S probably damaging Het
Other mutations in Olfr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Olfr95 APN 17 37210986 missense probably damaging 1.00
IGL03306:Olfr95 APN 17 37211677 missense probably damaging 1.00
PIT4377001:Olfr95 UTSW 17 37211089 missense probably benign 0.00
R0668:Olfr95 UTSW 17 37211644 missense probably damaging 1.00
R0909:Olfr95 UTSW 17 37210918 missense probably benign 0.33
R1442:Olfr95 UTSW 17 37211704 missense probably benign 0.00
R1557:Olfr95 UTSW 17 37211353 missense probably damaging 1.00
R3195:Olfr95 UTSW 17 37211536 missense possibly damaging 0.87
R3749:Olfr95 UTSW 17 37211800 missense possibly damaging 0.55
R3778:Olfr95 UTSW 17 37211758 missense probably benign
R4458:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R4591:Olfr95 UTSW 17 37211119 missense probably benign
R5058:Olfr95 UTSW 17 37211667 missense probably damaging 1.00
R5060:Olfr95 UTSW 17 37211416 missense probably benign 0.00
R5903:Olfr95 UTSW 17 37211021 nonsense probably null
R6294:Olfr95 UTSW 17 37211626 missense probably benign 0.19
R6689:Olfr95 UTSW 17 37211157 missense probably damaging 1.00
R7196:Olfr95 UTSW 17 37211193 missense probably damaging 1.00
R7677:Olfr95 UTSW 17 37211495 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCATTCCTCAGGCTGTAGATGAC -3'
(R):5'- TGGCTGCGCTCTGCAAATGTTC -3'

Sequencing Primer
(F):5'- CTCAGGCTGTAGATGACAGGATTG -3'
(R):5'- ATGGCCTATGACCGCTATGC -3'
Posted On2014-05-23