Incidental Mutation 'R1758:Gif'
ID195140
Institutional Source Beutler Lab
Gene Symbol Gif
Ensembl Gene ENSMUSG00000024682
Gene Namegastric intrinsic factor
Synonyms
MMRRC Submission 039790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1758 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11747554-11763447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11757815 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 266 (M266I)
Ref Sequence ENSEMBL: ENSMUSP00000025585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025585]
Predicted Effect probably damaging
Transcript: ENSMUST00000025585
AA Change: M266I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025585
Gene: ENSMUSG00000024682
AA Change: M266I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 8 308 2.6e-110 PFAM
Pfam:DUF4430 340 416 7.7e-9 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cobalamin transport protein family. It encodes a glycoprotein secreted by parietal cells of the gastric mucosa and is required for adequate absorption of vitamin B12. Vitamin B12 is necessary for erythrocyte maturation and mutations in this gene may lead to congenital pernicious anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit vitamin B12-sensitive susceptibility to bacterial infection and reduced body weight and altered blood chemistry that can be compensated by maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,562,237 R38G possibly damaging Het
4930590J08Rik T C 6: 91,915,222 V155A possibly damaging Het
Adgb A G 10: 10,426,605 S406P probably damaging Het
Adgrb2 C A 4: 130,011,875 T893N probably damaging Het
Adgrf5 T C 17: 43,424,593 probably null Het
Alms1 T A 6: 85,628,505 I2379N probably damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf4 C T 15: 80,257,213 T268I probably benign Het
BC067074 A G 13: 113,368,732 T2132A possibly damaging Het
Ccdc154 T C 17: 25,163,182 L25P probably damaging Het
Ccdc9 G A 7: 16,276,236 S381F probably damaging Het
Cdk17 C T 10: 93,208,250 T17M probably damaging Het
Cep128 T C 12: 91,347,578 N142S probably benign Het
Cep78 A G 19: 15,959,536 I602T probably damaging Het
Clasp1 C T 1: 118,548,025 T935I probably damaging Het
Cnr1 T C 4: 33,945,000 S463P probably damaging Het
Cntnap1 T A 11: 101,184,623 W876R probably damaging Het
Cntnap5c A G 17: 58,042,550 D286G probably damaging Het
Copa C T 1: 172,104,144 R321C probably damaging Het
Ctla2a T G 13: 60,935,442 E98A probably damaging Het
Cux1 A T 5: 136,392,322 D183E probably damaging Het
Cxcl15 A C 5: 90,801,464 T163P unknown Het
Ddias T C 7: 92,859,363 N448S probably benign Het
Dhx8 T C 11: 101,766,738 F1152S probably damaging Het
Dnah12 C A 14: 26,766,114 Q992K probably benign Het
Eno3 G T 11: 70,661,425 W301L possibly damaging Het
Faap100 A T 11: 120,377,233 V238E probably damaging Het
Fgf4 A G 7: 144,862,312 S137G probably benign Het
Fhod3 A C 18: 25,120,310 D1439A possibly damaging Het
Frem2 A G 3: 53,653,357 L1243P probably damaging Het
Gkn3 T G 6: 87,388,835 M1L probably benign Het
Gm10250 T C 15: 5,121,027 probably benign Het
Gm12185 T C 11: 48,908,032 T545A possibly damaging Het
Gm14226 T A 2: 155,025,458 L445H probably damaging Het
Gm3404 A T 5: 146,526,226 M73L probably benign Het
Gm4907 A G X: 23,906,751 I164V probably benign Het
Gm973 G T 1: 59,634,010 R976S unknown Het
Gpr146 A T 5: 139,393,382 H313L probably benign Het
Gys2 T A 6: 142,472,706 E32D probably damaging Het
Igsf10 G A 3: 59,329,196 T1188I probably benign Het
Igsf9b A T 9: 27,334,252 T1172S possibly damaging Het
Itga8 T A 2: 12,265,333 N114I possibly damaging Het
Itsn2 T A 12: 4,658,160 V795E possibly damaging Het
Kdm1b T A 13: 47,060,768 S197T probably benign Het
Kif5c G A 2: 49,723,133 R161Q probably benign Het
Krt33b T C 11: 100,025,535 Y232C probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1 A T 10: 127,588,584 N744K possibly damaging Het
Mcm10 C A 2: 5,004,050 L369F probably damaging Het
Muc5ac T A 7: 141,801,531 I1018N possibly damaging Het
Myom2 T C 8: 15,065,795 L70P probably benign Het
Myt1l T A 12: 29,827,242 N297K unknown Het
Ncr1 C T 7: 4,340,808 T98I probably benign Het
Nek3 T C 8: 22,160,262 E78G probably damaging Het
Nfatc3 T A 8: 106,099,136 N606K probably damaging Het
Nup107 T G 10: 117,761,343 D669A probably damaging Het
Olfr1113 A T 2: 87,213,414 Q174L probably benign Het
Olfr1264 T C 2: 90,021,329 T246A probably benign Het
Olfr922 A T 9: 38,815,575 H24L probably benign Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pcnx T C 12: 81,983,484 V1711A probably benign Het
Pik3c3 A G 18: 30,277,010 D99G probably damaging Het
Pinx1 C A 14: 63,919,575 T317K probably benign Het
Ppargc1b G T 18: 61,298,786 probably null Het
Pradc1 T A 6: 85,447,221 I119F possibly damaging Het
Psat1 G T 19: 15,914,879 T242K probably damaging Het
Psma6 G A 12: 55,407,532 C28Y probably damaging Het
Pyurf A T 6: 57,691,832 C58* probably null Het
Rab3gap2 C A 1: 185,283,884 A1331E probably benign Het
Rnase4 T C 14: 51,105,265 *149Q probably null Het
Ruvbl2 T C 7: 45,425,162 K184R probably benign Het
Scn7a T G 2: 66,680,183 M1292L probably benign Het
Scn7a A T 2: 66,700,887 Y549N probably damaging Het
Selp A G 1: 164,132,285 D370G possibly damaging Het
Slc22a15 G A 3: 101,860,453 Q386* probably null Het
Slc22a29 A G 19: 8,217,762 probably null Het
Slc26a7 A C 4: 14,548,491 I266S possibly damaging Het
Smpd4 T C 16: 17,626,008 S112P probably damaging Het
Smpd4 T A 16: 17,640,880 L165Q probably damaging Het
Snx33 A G 9: 56,926,698 I29T probably benign Het
Spen G A 4: 141,476,375 P1647L unknown Het
Strip2 T C 6: 29,941,941 probably null Het
Swsap1 C T 9: 21,955,984 R75* probably null Het
Tmem210 C T 2: 25,288,423 T32I probably damaging Het
Tnn C T 1: 160,147,584 R91H possibly damaging Het
Tnni1 G A 1: 135,808,682 R94H probably damaging Het
Tnrc6c T A 11: 117,760,730 V1693D probably benign Het
Trip4 G A 9: 65,874,977 Q158* probably null Het
Ttc39b T C 4: 83,237,349 E474G probably damaging Het
Usp50 C A 2: 126,775,862 C221F probably damaging Het
Vmn1r171 T C 7: 23,632,356 I2T probably benign Het
Wdr62 T A 7: 30,267,903 I309F probably damaging Het
Xdh A T 17: 73,910,209 V688E probably damaging Het
Zfyve26 A G 12: 79,238,944 L2353P probably damaging Het
Zgpat C A 2: 181,378,840 R269S probably damaging Het
Other mutations in Gif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Gif APN 19 11757762 missense probably benign 0.40
IGL02466:Gif APN 19 11752232 missense probably damaging 1.00
IGL02678:Gif APN 19 11748475 missense probably damaging 1.00
IGL02955:Gif APN 19 11747663 missense possibly damaging 0.93
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0135:Gif UTSW 19 11757754 missense probably damaging 1.00
R0606:Gif UTSW 19 11752294 missense possibly damaging 0.80
R1885:Gif UTSW 19 11752324 missense probably benign
R2054:Gif UTSW 19 11759006 missense probably benign 0.01
R3087:Gif UTSW 19 11760373 nonsense probably null
R4004:Gif UTSW 19 11759007 missense probably damaging 1.00
R4601:Gif UTSW 19 11752190 missense probably damaging 1.00
R4888:Gif UTSW 19 11752219 missense probably benign 0.16
R5546:Gif UTSW 19 11748495 missense possibly damaging 0.95
R5795:Gif UTSW 19 11760376 missense probably damaging 0.99
R6136:Gif UTSW 19 11750285 missense probably damaging 0.98
R6147:Gif UTSW 19 11747572 start gained probably benign
R7342:Gif UTSW 19 11763223 missense probably benign 0.00
R7814:Gif UTSW 19 11750187 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCATGGGACAGATGCTGTGAAAGAC -3'
(R):5'- ACACTGTGGCTGTGTGCTAGAAC -3'

Sequencing Primer
(F):5'- GTGATTCAAAACCTTGTGCTGC -3'
(R):5'- GCTGTGTGCTAGAACACATTG -3'
Posted On2014-05-23