Mutagenetix > Incidental Mutation

Incidental Mutation 'R1759:Speg'

195149

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

039791-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1759 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75401162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 855 (M855L)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087122
AA Change: M855L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: M855L

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113587
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207
AA Change: M1L

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113588
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207
AA Change: M1L

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113589
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207
AA Change: M1L

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113590
AA Change: M749L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: M749L

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122266
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207
AA Change: M1L

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132100

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: M602L

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,625,710	I369N	probably benign	Het
4931428F04Rik	A	T	8: 105,285,550	S88R	probably damaging	Het
9330159F19Rik	A	T	10: 29,218,276	M53L	possibly damaging	Het
Abca5	T	C	11: 110,293,848	D944G	probably benign	Het
Ankdd1b	T	C	13: 96,419,703	Y433C	probably damaging	Het
Aox3	A	G	1: 58,170,646		probably null	Het
Ap1g1	G	A	8: 109,833,221	G260E	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp13a4	T	A	16: 29,456,611	T352S	probably damaging	Het
Ccdc33	T	A	9: 58,117,446	N166Y	possibly damaging	Het
Ces2h	T	A	8: 105,016,611	D159E	probably damaging	Het
Chd1	T	A	17: 17,387,271	D360E	probably benign	Het
Col16a1	G	T	4: 130,084,269	G781V	probably damaging	Het
Col6a5	T	A	9: 105,930,846	E1001V	unknown	Het
Cyp3a59	T	G	5: 146,098,250	M246R	probably benign	Het
Dcn	T	C	10: 97,513,655	V263A	probably benign	Het
Dnttip2	A	G	3: 122,276,149	N338D	probably benign	Het
Entpd1	G	T	19: 40,612,524		probably null	Het
Epb41l1	A	G	2: 156,521,974	D801G	probably benign	Het
Fam186a	T	A	15: 99,966,881	K23*	probably null	Het
Gbe1	T	C	16: 70,488,041	M417T	probably benign	Het
Gmnc	T	A	16: 26,965,747	S3C	possibly damaging	Het
Gpr156	T	C	16: 37,948,221	S35P	probably damaging	Het
Grid1	T	C	14: 35,446,031	M504T	possibly damaging	Het
Gsdma3	T	C	11: 98,635,245	V265A	possibly damaging	Het
Hsd3b3	A	T	3: 98,742,083	I308N	probably damaging	Het
Inpp4b	A	G	8: 81,768,103	D49G	probably benign	Het
Ipmk	C	A	10: 71,381,303	Q227K	probably damaging	Het
Kalrn	T	A	16: 34,360,950	D88V	probably damaging	Het
Kansl1l	C	T	1: 66,801,888	M84I	probably damaging	Het
Kcnab2	T	G	4: 152,393,052	K363Q	probably damaging	Het
Kdm7a	C	A	6: 39,147,699		probably null	Het
Kiss1r	T	C	10: 79,921,778	L322P	probably damaging	Het
Lce1e	A	T	3: 92,707,871	C56*	probably null	Het
Lrpprc	T	C	17: 84,740,081	K908E	probably damaging	Het
Mak	C	A	13: 41,056,634	W42L	probably damaging	Het
Map3k21	A	G	8: 125,944,780	T936A	probably benign	Het
March7	C	T	2: 60,234,544	S388F	probably damaging	Het
Mgat2	A	T	12: 69,185,527	I292F	probably benign	Het
Myh3	C	A	11: 67,096,891	R1397S	probably damaging	Het
Myo5a	A	G	9: 75,181,993	D1135G	possibly damaging	Het
N4bp2	A	G	5: 65,826,613	E1667G	probably damaging	Het
Nbr1	A	G	11: 101,559,543	T43A	probably damaging	Het
Nip7	A	G	8: 107,058,135	N124S	probably benign	Het
Olfr410	G	A	11: 74,334,982	S83F	possibly damaging	Het
Olfr606	T	C	7: 103,452,149	S271P	probably benign	Het
Olfr790	T	A	10: 129,500,906	S7R	probably benign	Het
Olfr843	C	T	9: 19,249,088	V104I	probably benign	Het
Olfr922	T	C	9: 38,815,898	Y132H	probably damaging	Het
Otoa	T	C	7: 121,134,103	L731P	probably damaging	Het
Pcnx2	G	A	8: 125,773,978	P1458S	probably damaging	Het
Pfpl	A	G	19: 12,429,860	T492A	probably damaging	Het
Pgm2	A	G	4: 99,967,108	D326G	probably damaging	Het
Plekhh1	T	A	12: 79,072,761	Y953N	probably damaging	Het
Pnkd	G	A	1: 74,348,763	A195T	probably damaging	Het
Ppib	C	T	9: 66,061,482	Q51*	probably null	Het
Ppip5k1	G	T	2: 121,350,586	T13K	probably benign	Het
Psmg2	A	T	18: 67,648,176	S113C	probably benign	Het
Rapgef2	A	G	3: 79,066,731	M1584T	possibly damaging	Het
Rbm12b1	A	C	4: 12,145,424	R465S	probably damaging	Het
Reln	A	G	5: 22,010,289	Y1055H	probably damaging	Het
Ros1	A	T	10: 52,120,826	I1250K	probably damaging	Het
Samd9l	C	A	6: 3,373,401	V1287F	probably damaging	Het
Sgce	A	T	6: 4,689,765	I356N	probably damaging	Het
Sh3tc1	C	T	5: 35,705,904	E980K	possibly damaging	Het
Sil1	T	C	18: 35,418,098	E68G	possibly damaging	Het
Slc18a1	A	G	8: 69,065,585	I259T	possibly damaging	Het
Slc6a20b	A	C	9: 123,608,997		probably null	Het
Smg7	G	T	1: 152,848,846	T536K	probably benign	Het
Smyd4	A	G	11: 75,382,366	Y84C	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Sorbs2	A	T	8: 45,763,019	*50C	probably null	Het
Srrt	G	T	5: 137,302,950	H71Q	probably damaging	Het
St6galnac5	A	G	3: 152,846,493	S146P	probably damaging	Het
Syne1	T	A	10: 5,349,369	Q962L	probably damaging	Het
Tiam2	A	G	17: 3,516,003	H1441R	probably damaging	Het
Tmem45a	C	T	16: 56,822,402	M135I	probably benign	Het
Tpr	A	T	1: 150,429,524	E1521D	probably benign	Het
Uba3	C	T	6: 97,196,904	G107R	probably damaging	Het
Unc45b	G	T	11: 82,929,499	V590F	probably benign	Het
Vmn1r14	A	T	6: 57,234,312	T292S	probably benign	Het
Vmn2r102	T	A	17: 19,694,493	N773K	probably damaging	Het
Vps13d	A	T	4: 145,155,857	D1055E	probably benign	Het
Wfs1	G	C	5: 36,967,015	A844G	probably damaging	Het
Zfp398	A	G	6: 47,859,478	T71A	possibly damaging	Het
Zfp507	C	A	7: 35,775,978	A145S	probably damaging	Het
Zfp971	A	T	2: 178,033,929	E440D	probably damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9553:Speg	UTSW	1	75418001	missense	probably benign	0.00
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTCTAAAGCCATCAGTGGCTCTTC -3'
(R):5'- ATGCCAAAGCATCAGGGGTGAC -3'

Sequencing Primer
(F):5'- CTAACATGAGGATAGGCTTTGGC -3'
(R):5'- TCCAGGTCACAAGGGTTAACG -3'

Posted On

2014-05-23