Incidental Mutation 'R1759:Epb41l1'
ID195154
Institutional Source Beutler Lab
Gene Symbol Epb41l1
Ensembl Gene ENSMUSG00000027624
Gene Nameerythrocyte membrane protein band 4.1 like 1
SynonymsEpb4.1l1, 4.1N
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156420909-156543214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156521974 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 801 (D801G)
Ref Sequence ENSEMBL: ENSMUSP00000121161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103135] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109572] [ENSMUST00000109574] [ENSMUST00000109577] [ENSMUST00000125153]
Predicted Effect probably benign
Transcript: ENSMUST00000029155
SMART Domains Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103135
SMART Domains Protein: ENSMUSP00000099424
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103136
SMART Domains Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103137
SMART Domains Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109572
SMART Domains Protein: ENSMUSP00000105200
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 215 5.6e-12 SMART
FERM_C 219 309 1.2e-43 SMART
FA 311 357 9e-22 SMART
low complexity region 386 399 N/A INTRINSIC
Pfam:SAB 408 459 2.2e-21 PFAM
Pfam:4_1_CTD 514 619 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109574
SMART Domains Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 480 531 4.8e-24 PFAM
Pfam:4_1_CTD 610 718 4.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109577
SMART Domains Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 481 532 5.9e-24 PFAM
low complexity region 594 603 N/A INTRINSIC
Pfam:4_1_CTD 758 855 5.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125153
AA Change: D801G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624
AA Change: D801G

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 492 543 7.4e-25 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Epb41l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Epb41l1 APN 2 156525019 missense probably damaging 1.00
IGL00852:Epb41l1 APN 2 156503718 missense probably damaging 1.00
IGL02148:Epb41l1 APN 2 156511828 intron probably benign
IGL02164:Epb41l1 APN 2 156494949 splice site probably benign
IGL02515:Epb41l1 APN 2 156537013 missense probably damaging 1.00
R0787:Epb41l1 UTSW 2 156494090 missense probably damaging 0.98
R1450:Epb41l1 UTSW 2 156511825 intron probably benign
R1566:Epb41l1 UTSW 2 156521959 missense probably benign 0.06
R1812:Epb41l1 UTSW 2 156496511 missense probably damaging 1.00
R1908:Epb41l1 UTSW 2 156510817 missense possibly damaging 0.80
R2152:Epb41l1 UTSW 2 156514128 missense probably damaging 1.00
R3023:Epb41l1 UTSW 2 156514209 missense probably damaging 0.99
R4178:Epb41l1 UTSW 2 156521557 missense probably benign
R4491:Epb41l1 UTSW 2 156522168 missense probably benign 0.00
R4610:Epb41l1 UTSW 2 156509261 missense possibly damaging 0.71
R4770:Epb41l1 UTSW 2 156529424 missense probably benign 0.00
R5038:Epb41l1 UTSW 2 156521410 missense probably benign 0.12
R5049:Epb41l1 UTSW 2 156524939 missense possibly damaging 0.95
R5129:Epb41l1 UTSW 2 156509281 missense possibly damaging 0.80
R5624:Epb41l1 UTSW 2 156533771 splice site probably benign
R5780:Epb41l1 UTSW 2 156496525 missense probably damaging 1.00
R5810:Epb41l1 UTSW 2 156499655 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156503788 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156524983 missense probably benign
R5961:Epb41l1 UTSW 2 156521786 missense probably benign 0.25
R6118:Epb41l1 UTSW 2 156522477 missense probably benign 0.13
R6496:Epb41l1 UTSW 2 156533796 missense possibly damaging 0.92
R6861:Epb41l1 UTSW 2 156525222 missense probably benign
R6959:Epb41l1 UTSW 2 156499587 missense probably benign 0.03
R7009:Epb41l1 UTSW 2 156534683 splice site probably null
R7036:Epb41l1 UTSW 2 156529402 missense probably benign
R7046:Epb41l1 UTSW 2 156526892 missense possibly damaging 0.56
R7263:Epb41l1 UTSW 2 156495123 critical splice donor site probably null
R7322:Epb41l1 UTSW 2 156503851 missense probably damaging 0.98
R7398:Epb41l1 UTSW 2 156534762 missense probably damaging 1.00
X0065:Epb41l1 UTSW 2 156509277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACGAGACTGACACCTCCTTC -3'
(R):5'- CATCTTCAGCTACATCGGCCACTG -3'

Sequencing Primer
(F):5'- TGACACCTCCTTCGCAGAG -3'
(R):5'- TACATCGGCCACTGGGTAG -3'
Posted On2014-05-23