Incidental Mutation 'R1759:Col16a1'
ID195167
Institutional Source Beutler Lab
Gene Symbol Col16a1
Ensembl Gene ENSMUSG00000040690
Gene Namecollagen, type XVI, alpha 1
Synonyms2700007F12Rik, [a]1 (XVI) collagen, A530052M23Rik
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1759 (G1)
Quality Score163
Status Not validated
Chromosome4
Chromosomal Location130047840-130099283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130084269 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 781 (G781V)
Ref Sequence ENSEMBL: ENSMUSP00000120339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044565] [ENSMUST00000143432] [ENSMUST00000143577]
Predicted Effect unknown
Transcript: ENSMUST00000044565
AA Change: G1081V
SMART Domains Protein: ENSMUSP00000035802
Gene: ENSMUSG00000040690
AA Change: G1081V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_4 330 355 2.35e-7 PROSPERO
Pfam:Collagen 372 431 1.6e-8 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_2 546 562 2.68e-9 PROSPERO
internal_repeat_1 547 580 9.92e-10 PROSPERO
Pfam:Collagen 584 646 1.5e-9 PFAM
internal_repeat_5 662 689 6.35e-7 PROSPERO
internal_repeat_3 662 731 1.96e-8 PROSPERO
internal_repeat_7 679 695 2.06e-5 PROSPERO
internal_repeat_6 682 730 7.63e-6 PROSPERO
internal_repeat_1 685 742 9.92e-10 PROSPERO
Pfam:Collagen 796 850 3.4e-9 PFAM
internal_repeat_5 859 889 6.35e-7 PROSPERO
low complexity region 891 922 N/A INTRINSIC
low complexity region 990 1000 N/A INTRINSIC
Pfam:Collagen 1001 1064 1.4e-10 PFAM
low complexity region 1090 1112 N/A INTRINSIC
internal_repeat_7 1114 1130 2.06e-5 PROSPERO
low complexity region 1132 1162 N/A INTRINSIC
low complexity region 1171 1222 N/A INTRINSIC
low complexity region 1230 1282 N/A INTRINSIC
internal_repeat_2 1283 1299 2.68e-9 PROSPERO
internal_repeat_6 1287 1335 7.63e-6 PROSPERO
Pfam:Collagen 1350 1411 1.8e-9 PFAM
Pfam:Collagen 1446 1503 5.3e-10 PFAM
low complexity region 1505 1525 N/A INTRINSIC
low complexity region 1528 1549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129937
Predicted Effect probably benign
Transcript: ENSMUST00000143432
SMART Domains Protein: ENSMUSP00000120384
Gene: ENSMUSG00000040690

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_1 330 353 5.41e-8 PROSPERO
Pfam:Collagen 372 426 2.1e-9 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_1 546 569 5.41e-8 PROSPERO
internal_repeat_2 547 580 5.41e-8 PROSPERO
Pfam:Collagen 584 646 2.7e-10 PFAM
Pfam:Collagen 659 736 8.6e-8 PFAM
Pfam:Collagen 745 797 1.6e-7 PFAM
Pfam:Collagen 796 850 5.9e-10 PFAM
Pfam:Collagen 848 923 1.6e-7 PFAM
low complexity region 974 984 N/A INTRINSIC
Pfam:Collagen 987 1045 1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143577
AA Change: G781V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690
AA Change: G781V

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151541
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Col16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Col16a1 APN 4 130094552 splice site probably null
IGL00885:Col16a1 APN 4 130096910 missense probably damaging 1.00
IGL01931:Col16a1 APN 4 130072841 missense possibly damaging 0.47
IGL02142:Col16a1 APN 4 130051647 splice site probably null
IGL02307:Col16a1 APN 4 130059009 missense probably damaging 1.00
IGL02731:Col16a1 APN 4 130053530 unclassified probably benign
IGL02742:Col16a1 APN 4 130061379 unclassified probably benign
PIT4520001:Col16a1 UTSW 4 130051663 missense unknown
R0127:Col16a1 UTSW 4 130052857 missense probably damaging 1.00
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0132:Col16a1 UTSW 4 130067096 missense unknown
R0299:Col16a1 UTSW 4 130058318 frame shift probably null
R0355:Col16a1 UTSW 4 130058413 splice site probably benign
R0395:Col16a1 UTSW 4 130073109 missense probably damaging 1.00
R0485:Col16a1 UTSW 4 130090497 splice site probably benign
R0573:Col16a1 UTSW 4 130068475 splice site probably benign
R1274:Col16a1 UTSW 4 130097801 missense probably damaging 0.98
R1619:Col16a1 UTSW 4 130098940 missense probably damaging 1.00
R1832:Col16a1 UTSW 4 130077057 splice site probably null
R1861:Col16a1 UTSW 4 130061724 unclassified probably benign
R1862:Col16a1 UTSW 4 130092782 critical splice donor site probably null
R1981:Col16a1 UTSW 4 130065443 missense unknown
R2265:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2269:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2291:Col16a1 UTSW 4 130067040 missense unknown
R3176:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3276:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3552:Col16a1 UTSW 4 130077041 missense probably benign 0.10
R4049:Col16a1 UTSW 4 130068752 missense probably damaging 1.00
R4241:Col16a1 UTSW 4 130099050 missense probably damaging 0.98
R4327:Col16a1 UTSW 4 130094551 critical splice donor site probably null
R4591:Col16a1 UTSW 4 130061799 splice site probably null
R4664:Col16a1 UTSW 4 130062090 unclassified probably benign
R4803:Col16a1 UTSW 4 130055108 unclassified probably benign
R4925:Col16a1 UTSW 4 130054176 missense probably damaging 1.00
R4961:Col16a1 UTSW 4 130054479 splice site probably null
R5016:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5027:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5085:Col16a1 UTSW 4 130054171 missense probably damaging 1.00
R5088:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5089:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5408:Col16a1 UTSW 4 130093105 utr 3 prime probably benign
R5472:Col16a1 UTSW 4 130092771 utr 3 prime probably benign
R5564:Col16a1 UTSW 4 130053358 missense probably damaging 1.00
R5597:Col16a1 UTSW 4 130058304 missense probably damaging 1.00
R5703:Col16a1 UTSW 4 130053299 missense probably damaging 0.96
R6054:Col16a1 UTSW 4 130061722 unclassified probably benign
R6226:Col16a1 UTSW 4 130055089 unclassified probably benign
R6362:Col16a1 UTSW 4 130066190 missense unknown
R6448:Col16a1 UTSW 4 130058988 missense probably damaging 1.00
R6449:Col16a1 UTSW 4 130066693 missense unknown
R6502:Col16a1 UTSW 4 130055994 missense probably damaging 1.00
R6949:Col16a1 UTSW 4 130059323 missense probably damaging 1.00
R6969:Col16a1 UTSW 4 130093087 utr 3 prime probably benign
R7086:Col16a1 UTSW 4 130052980 splice site probably null
R7375:Col16a1 UTSW 4 130065501 missense unknown
R7703:Col16a1 UTSW 4 130096502 missense unknown
R7808:Col16a1 UTSW 4 130073264 missense unknown
R7904:Col16a1 UTSW 4 130054208 nonsense probably null
R7987:Col16a1 UTSW 4 130054208 nonsense probably null
RF014:Col16a1 UTSW 4 130093067 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CCACCACTTTGATGGGAAGGAAGG -3'
(R):5'- TCACAGGAAGATCTCCAGTCCAGC -3'

Sequencing Primer
(F):5'- GCTATTATGAGTCCCAGGCTCAG -3'
(R):5'- TCCAGTCCAGCGGATGAAG -3'
Posted On2014-05-23