Incidental Mutation 'R1759:Olfr790'
ID195211
Institutional Source Beutler Lab
Gene Symbol Olfr790
Ensembl Gene ENSMUSG00000044025
Gene Nameolfactory receptor 790
SynonymsGA_x6K02T2PULF-11179777-11180721, MOR112-1
MMRRC Submission 039791-MU
Accession Numbers

Genbank: NM_146933

Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129498492-129503342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129500906 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 7 (S7R)
Ref Sequence ENSEMBL: ENSMUSP00000151759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056002] [ENSMUST00000203966] [ENSMUST00000215067] [ENSMUST00000218901]
Predicted Effect probably benign
Transcript: ENSMUST00000056002
SMART Domains Protein: ENSMUSP00000052235
Gene: ENSMUSG00000044025

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 5.6e-53 PFAM
Pfam:7tm_1 47 296 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203966
SMART Domains Protein: ENSMUSP00000145450
Gene: ENSMUSG00000044025

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 5.6e-53 PFAM
Pfam:7tm_1 47 296 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215067
Predicted Effect probably benign
Transcript: ENSMUST00000218901
AA Change: S7R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Olfr790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Olfr790 APN 10 129501646 missense probably damaging 1.00
IGL01575:Olfr790 APN 10 129501567 missense probably benign 0.01
IGL02389:Olfr790 APN 10 129501070 missense probably benign
IGL02601:Olfr790 APN 10 129501854 makesense probably null
G5030:Olfr790 UTSW 10 129501537 missense probably benign 0.00
R0785:Olfr790 UTSW 10 129500881 critical splice acceptor site probably null
R0850:Olfr790 UTSW 10 129501724 missense probably damaging 0.99
R0899:Olfr790 UTSW 10 129501432 missense probably damaging 1.00
R1167:Olfr790 UTSW 10 129501150 missense probably benign 0.03
R1515:Olfr790 UTSW 10 129501591 missense probably damaging 1.00
R1557:Olfr790 UTSW 10 129501622 missense probably damaging 1.00
R1892:Olfr790 UTSW 10 129501033 missense probably benign 0.02
R4296:Olfr790 UTSW 10 129501470 nonsense probably null
R4681:Olfr790 UTSW 10 129501564 missense probably damaging 1.00
R5046:Olfr790 UTSW 10 129501309 missense possibly damaging 0.57
R5309:Olfr790 UTSW 10 129501514 missense probably damaging 1.00
R5312:Olfr790 UTSW 10 129501514 missense probably damaging 1.00
R5550:Olfr790 UTSW 10 129501783 missense probably damaging 1.00
R5788:Olfr790 UTSW 10 129500894 missense probably benign
R5788:Olfr790 UTSW 10 129500910 start codon destroyed probably null 0.99
R7457:Olfr790 UTSW 10 129501706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACATGGGCAAACCAGGAAC -3'
(R):5'- TGACAAGGAATCTGGGAATGCAGAC -3'

Sequencing Primer
(F):5'- ataatatccagctttacgaaggagac -3'
(R):5'- TCTGGGAATGCAGACAGATG -3'
Posted On2014-05-23